XLOC_010418


Basic Information

Item Value
gene id XLOC_010418
gene name NA
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 6248023 ~ 6249246 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00022089
GAGAAAAGCAGCTTCTGCATTGCTGACGGCTCAGAAATATCACAAGGCAAGCAAGTAGAAAACCTAAATTTTTCCTCTCCCTCTTAAGAAGAATGATGCCTTTCACCTGCATCATTTAAACTCAAGATTTGGAGCTGCTTTTTTCTCTTCTGGATGAGATTACAGGTGGACGTTTGTGACCAGCCCCGTGGCCTTTTTGCATGGCGCTCATTGTGTCCTCTCCGGCTTTAAGGCAACTCTAGTTTAAGCTACTATACTGAAGCAGGA

Function

GO:

id name namespace
GO:0048731 system development biological_process
GO:0048468 cell development biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0030154 cell differentiation biological_process
GO:0048513 animal organ development biological_process
GO:1990399 epithelium regeneration biological_process
GO:0030182 neuron differentiation biological_process
GO:0007275 multicellular organism development biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0009653 anatomical structure morphogenesis biological_process
GO:0048856 anatomical structure development biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:0010468 regulation of gene expression biological_process
GO:0048869 cellular developmental process biological_process
GO:0045595 regulation of cell differentiation biological_process
GO:0043696 dedifferentiation biological_process
GO:0043697 cell dedifferentiation biological_process
GO:0050767 regulation of neurogenesis biological_process
GO:0070654 sensory epithelium regeneration biological_process
GO:0050793 regulation of developmental process biological_process
GO:0007399 nervous system development biological_process
GO:0048934 peripheral nervous system neuron differentiation biological_process
GO:0048935 peripheral nervous system neuron development biological_process
GO:0032501 multicellular organismal process biological_process
GO:0048936 peripheral nervous system neuron axonogenesis biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032502 developmental process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0060284 regulation of cell development biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0007417 central nervous system development biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0060290 transdifferentiation biological_process
GO:0007420 brain development biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:0022008 neurogenesis biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0048699 generation of neurons biological_process
GO:0060322 head development biological_process
GO:0051960 regulation of nervous system development biological_process
GO:0045121 membrane raft cellular_component
GO:0098857 membrane microdomain cellular_component
GO:0005901 caveola cellular_component
GO:0044853 plasma membrane raft cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:0000987 cis-regulatory region sequence-specific DNA binding molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0046983 protein dimerization activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00022089 True 267 lncRNA 0.44 2 6248023 6249246

Neighbor

gene id symbol gene type direction distance location
XLOC_010417 ctnnb1 coding downstream 42233 6182501 ~ 6205790 (-)
XLOC_010415 trak1a coding downstream 374157 5786770 ~ 5873866 (-)
XLOC_010416 BX957314.1 coding downstream 377334 5870573 ~ 5870689 (-)
XLOC_010414 NA coding downstream 461981 5746308 ~ 5786042 (-)
XLOC_010413 ndufa3 coding downstream 526637 5717760 ~ 5721386 (-)
XLOC_010419 NA coding upstream 41927 6291173 ~ 6351690 (-)
XLOC_010420 scgn coding upstream 107214 6356460 ~ 6377672 (-)
XLOC_010421 NA coding upstream 134284 6383530 ~ 6386642 (-)
XLOC_010422 ndufb9 coding upstream 137695 6386941 ~ 6391279 (-)
XLOC_010423 mboat1 coding upstream 146065 6395311 ~ 6424818 (-)
XLOC_010626 CR392024.2 misc upstream 14645866 20895112 ~ 20895175 (-)
XLOC_010411 NA non-coding downstream 604285 5636286 ~ 5643738 (-)
XLOC_010409 NA non-coding downstream 659403 5453180 ~ 5588620 (-)
XLOC_010408 NA non-coding downstream 1074580 5169775 ~ 5173443 (-)
XLOC_010424 NA non-coding upstream 226770 6476016 ~ 6484227 (-)
XLOC_010425 NA non-coding upstream 263100 6512346 ~ 6556501 (-)
XLOC_010426 NA non-coding upstream 338776 6588022 ~ 6591170 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) G100213 NA non-coding CI01000016 null 10016153 ~ 10016831 (-)