G331737


Basic Information

Item Value
gene id G331737
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000113
NCBI id null
chromosome length 2886875
location 1567829 ~ 1568207 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU377084
TTTTGAACTACTGCTATATTTAGACACACAGACATCAAGAATCAGCGTATGAATGGCATGTCACCATTGTTGAGATTCATACGCTGATGCTTTATGTCTGTGTGTGTCTAAATATGGTAGTAGTTCAAAATGTTTTGTGAACAATGTGTTTAAAAAAAGTATCTGATTACCACAACAGCACTGGACCTCTTGTTATAGTATCACACTGTTTAGAACACAATATTTGAAATGCATTTAACACACTTTTCTTCAGGGTGAGATCTGTGGCTCAGGATGTTTGATGATTCTTCATCAACAAACATTCAATAGATCATCCACAGCATTTCTCTCGGCTTTTTTGCCTTAACGACTGTGTTTTACAAACACACAGTTACAGCAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU377084 True 379 lncRNA 0.36 1 1567829 1568207

Neighbor

gene id symbol gene type direction distance location
CI01000113_01547153_01553082 NA coding upstream 14043 1546736 ~ 1553786 (+)
CI01000113_01530888_01533572 NA coding upstream 34257 1530791 ~ 1533572 (+)
CI01000113_01515238_01529826 NA coding upstream 37878 1515171 ~ 1529951 (+)
CI01000113_01510550_01513751 NA coding upstream 53623 1510550 ~ 1514206 (+)
CI01000113_01507537_01509522 NA coding upstream 58307 1507537 ~ 1509522 (+)
CI01000113_01666106_01684663 NA coding downstream 97859 1666066 ~ 1684701 (+)
CI01000113_01691097_01696776 NA coding downstream 122890 1691062 ~ 1696776 (+)
CI01000113_01698764_01709585 NA coding downstream 130417 1698624 ~ 1709708 (+)
CI01000113_01716646_01752755 NA coding downstream 147542 1715749 ~ 1753351 (+)
CI01000113_01761054_01815819 NA coding downstream 192720 1760927 ~ 1815997 (+)
G331735 NA non-coding upstream 12359 1555211 ~ 1555470 (+)
G331732 NA non-coding upstream 23752 1543847 ~ 1544077 (+)
G331709 NA non-coding upstream 76757 1488561 ~ 1491072 (+)
G331611 NA non-coding upstream 168167 1393245 ~ 1399662 (+)
G331702 NA non-coding upstream 178278 1389312 ~ 1389551 (+)
G331744 NA non-coding downstream 17491 1585698 ~ 1586364 (+)
G331746 NA non-coding downstream 33169 1601376 ~ 1601608 (+)
G331747 NA non-coding downstream 41014 1609221 ~ 1609426 (+)
G331755 NA non-coding downstream 67944 1636151 ~ 1636660 (+)
G331756 NA non-coding downstream 69911 1638118 ~ 1638433 (+)
CI01000113_01424978_01425704 NA other upstream 142123 1424968 ~ 1425835 (+)
G331615 NA other upstream 321256 1246291 ~ 1246573 (+)
G331487 NA other upstream 645696 917735 ~ 922133 (+)
G331470 NA other upstream 651292 913392 ~ 916537 (+)
G331260 NA other upstream 1233208 334158 ~ 334621 (+)
G331767 NA other downstream 94578 1662785 ~ 1663255 (+)
G331759 NA other downstream 99795 1668002 ~ 1828903 (+)
CI01000113_02342987_02345449 SYCE2 other downstream 775214 2342987 ~ 2346006 (+)
CI01000113_02548934_02576888 TBL3 other downstream 1000560 2548934 ~ 2577790 (+)

Expression


Co-expression Network