G387838


Basic Information

Item Value
gene id G387838
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000201
NCBI id null
chromosome length 704500
location 406213 ~ 406445 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU443907
TGAAAATGTGTTTCAAAGTGCAAGTTTTTAAAAATGATACCATTATCGTCTCCATGTAAACTACAAAAACGTGAATTTGTGAAAACGGTGACGTCATGCACGTGTATTACGTGTTCAGTCTATAGGAGTGTAGTGTTTCTTTACAAAGTGACATCGCCATCTACTGGCCTGACAGCAGAATACAGCGATTTTAGTCGTTTTCACAGATCCGTGTGAACGGGGATCATTTTGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU443907 True 233 lncRNA 0.39 1 406213 406445

Neighbor

gene id symbol gene type direction distance location
CI01000201_00394321_00396791 NA coding upstream 9218 394152 ~ 396995 (+)
CI01000201_00254354_00285896 NA coding upstream 120151 254115 ~ 286062 (+)
CI01000201_00124616_00139299 NA coding upstream 266686 124616 ~ 139527 (+)
CI01000201_00098073_00121392 NA coding upstream 284419 98017 ~ 121794 (+)
CI01000201_00066137_00066334 NA coding upstream 339766 63803 ~ 66447 (+)
CI01000201_00421647_00426906 TBL1X coding downstream 14141 420586 ~ 426906 (+)
CI01000201_00473896_00474283 NA coding downstream 67451 473896 ~ 474436 (+)
CI01000201_00547876_00556142 GPM6BB, GPM6B coding downstream 141431 547876 ~ 556255 (+)
CI01000201_00572895_00575129 TRAPPC2 coding downstream 166274 572719 ~ 575704 (+)
CI01000201_00576577_00577506 NA coding downstream 170132 576577 ~ 578901 (+)
G387807 NA non-coding upstream 21111 340187 ~ 385102 (+)
G387804 NA non-coding upstream 51563 322822 ~ 354650 (+)
G387741 NA non-coding upstream 117681 240952 ~ 288532 (+)
G387739 NA non-coding upstream 137421 234891 ~ 268792 (+)
G387650 NA non-coding upstream 250487 154840 ~ 155726 (+)
G387848 NA non-coding downstream 82960 489405 ~ 489702 (+)
G387849 NA non-coding downstream 92341 498786 ~ 527371 (+)
G387819 NA non-coding downstream 116464 522909 ~ 613385 (+)
G387862 NA non-coding downstream 182020 588465 ~ 589474 (+)
G387827 NA non-coding downstream 208486 614931 ~ 616868 (+)

Expression


Co-expression Network