G389594


Basic Information

Item Value
gene id G389594
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000206
NCBI id null
chromosome length 757353
location 54138 ~ 54365 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU446028
TGTGTGAGGCCCCCCCACCTTAATCATTATGCTTTCTTGAAAAAATGTATTTAGTGCCATACATGGTCCACACGCAAATATTAAGGTTAACTGGCACACGCTCATCGAGACAGCCAATACTACAGTTTTTCTTCTATGTCCCTTCAACTGGTGGACCACCACAGTAAGACAATTACCACCACGTTGCATAGGTAAAATGTGAAATTGAAAATCATAAATCATATAAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU446028 True 228 lncRNA 0.39 1 54138 54365

Neighbor

gene id symbol gene type direction distance location
CI01000206_00029745_00051502 NA coding upstream 2217 29745 ~ 51921 (+)
CI01000206_00021515_00023628 NA coding upstream 30505 21515 ~ 23633 (+)
CI01000206_00178241_00202393 NA coding downstream 123780 178145 ~ 203585 (+)
CI01000206_00220974_00253610 NA coding downstream 166609 220974 ~ 253610 (+)
CI01000206_00385497_00393583 R3HDM1 coding downstream 331132 385497 ~ 393583 (+)
CI01000206_00426915_00452327 NA coding downstream 372429 426794 ~ 453106 (+)
CI01000206_00475810_00481198 LCP1.S, LCP1 coding downstream 421445 475810 ~ 481222 (+)
G389623 NA non-coding downstream 15220 69585 ~ 70154 (+)
G389632 NA non-coding downstream 45263 99628 ~ 134577 (+)
G389597 NA non-coding downstream 87712 142077 ~ 146208 (+)
G389642 NA non-coding downstream 103190 157555 ~ 158909 (+)
G389658 NA non-coding downstream 241118 295483 ~ 295961 (+)
G389767 NA other downstream 506780 561145 ~ 565669 (+)
G389725 NA other downstream 525466 579831 ~ 583898 (+)
G389774 NA other downstream 551970 606335 ~ 608065 (+)

Expression


Co-expression Network