G389642


Basic Information

Item Value
gene id G389642
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000206
NCBI id null
chromosome length 757353
location 157555 ~ 158909 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU446081
TACAGACATCTGCCTGCCTAGTACACAACCGATATCAGCCTAGCACACTACAGATTTCCAAAACACCCTACAGACATCAGCACAGAAGAACAGATACTCACATGACGGAATGATGAACTGTGGTTCCGTGTTTCCTGCATATCCCAGTTTAGTGTACCCTGTGCCACAATCCACAACGCATGCCGGTAACCGAGCGGCCATATCGAGTGGTTAAAGCGCCGGTGAGCTCCCGGTACGAATGATCAGTCGCTCCGTTTGTGCGCGAGGCGGAACCCGGAAACGCGAAGGGAAGCGTTTTTCCACTTCCGCATT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU446081 True 312 lncRNA 0.52 2 157555 158909

Neighbor

gene id symbol gene type direction distance location
CI01000206_00029745_00051502 NA coding upstream 105634 29745 ~ 51921 (+)
CI01000206_00021515_00023628 NA coding upstream 133922 21515 ~ 23633 (+)
CI01000206_00178241_00202393 NA coding downstream 19236 178145 ~ 203585 (+)
CI01000206_00220974_00253610 NA coding downstream 62065 220974 ~ 253610 (+)
CI01000206_00385497_00393583 R3HDM1 coding downstream 226588 385497 ~ 393583 (+)
CI01000206_00426915_00452327 NA coding downstream 267885 426794 ~ 453106 (+)
CI01000206_00475810_00481198 LCP1.S, LCP1 coding downstream 316901 475810 ~ 481222 (+)
G389597 NA non-coding upstream 11347 142077 ~ 146208 (+)
G389632 NA non-coding upstream 22978 99628 ~ 134577 (+)
G389623 NA non-coding upstream 87401 69585 ~ 70154 (+)
G389594 NA non-coding upstream 103190 54138 ~ 54365 (+)
G389658 NA non-coding downstream 136574 295483 ~ 295961 (+)
G389672 NA non-coding downstream 168052 326961 ~ 327166 (+)
G389684 NA non-coding downstream 184879 343788 ~ 344204 (+)
G389728 NA non-coding downstream 346608 505517 ~ 505814 (+)
G389753 NA non-coding downstream 352020 510929 ~ 511157 (+)
G389767 NA other downstream 402236 561145 ~ 565669 (+)
G389725 NA other downstream 420922 579831 ~ 583898 (+)
G389774 NA other downstream 447426 606335 ~ 608065 (+)

Expression


Co-expression Network