G389769


Basic Information

Item Value
gene id G389769
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000206
NCBI id null
chromosome length 757353
location 596915 ~ 597114 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU446217
CATTGTACCACAATGGAAAAATTGAAACATTTGGCATTTTCATGTAGAAAAAAGAAATATGTTTATTGAAAACATCAATTTCTTTCGCTAGACACTTGAACAAACAAATTTATCCAGTTTTAAAAGCTTCATATTTAATAAAAAGTAACATTTTATATCCAGCTGTTGCCCTCAGGCAACACTGTACCACAGTGGAACAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU446217 True 200 lncRNA 0.31 1 596915 597114

Neighbor

gene id symbol gene type direction distance location
CI01000206_00571550_00572992 NA coding upstream 23626 571550 ~ 573289 (+)
CI01000206_00537962_00541275 NA coding upstream 54765 537889 ~ 542150 (+)
CI01000206_00475810_00481198 LCP1.S, LCP1 coding upstream 115693 475810 ~ 481222 (+)
CI01000206_00426915_00452327 NA coding upstream 143809 426794 ~ 453106 (+)
CI01000206_00385497_00393583 R3HDM1 coding upstream 203332 385497 ~ 393583 (+)
CI01000206_00666815_00743152 SH3RF3 coding downstream 69701 666815 ~ 743152 (+)
CI01000206_00748542_00751311 NA coding downstream 151428 748542 ~ 751571 (+)
G389729 NA non-coding upstream 4028 592305 ~ 592887 (+)
G389764 NA non-coding upstream 41639 555061 ~ 555276 (+)
G389759 NA non-coding upstream 69160 527097 ~ 527755 (+)
G389753 NA non-coding upstream 85758 510929 ~ 511157 (+)
G389728 NA non-coding upstream 91101 505517 ~ 505814 (+)
G389730 NA non-coding downstream 6859 603973 ~ 606233 (+)
G389752 NA non-coding downstream 49337 646451 ~ 689149 (+)
G389725 NA other upstream 13017 579831 ~ 583898 (+)
G389767 NA other upstream 31246 561145 ~ 565669 (+)
G389774 NA other downstream 9221 606335 ~ 608065 (+)

Expression


Co-expression Network