CI01000299_02891830_02905146 (NRP2B, NRP2A, NRP2)


Basic Information

Item Value
gene id CI01000299_02891830_02905146
gene name NRP2B, NRP2A, NRP2
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 2891574 ~ 2905146 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000299_02891830_02905146.mRNA
TTGAGACATGTGGAGGCCACCTGGATGCCAGCGATGCTGGTTACATCACATCTCCAGGATATCCCCTGGAATACCCGCCCCATCAGAGCTGCCAGTGGGTGATCAGCGCACCTGAACCCTCACAGCGCATCGTGCTCAACTTCAACCCCCACTTTGAGCTGGAACGACTGGATTGCAGGTATGACTTCATAGAGATCCGAGATGGGAATTCTGAGTCTGCGGACCTGCTGGGAAAGCACTGCAGTAACATCGCTCCTCCTGCCATCATTTCCTCCGGTCCCGTCATCCACATCAAGTTCGTGTCTGATTATGCGCACCAGGGTGCTGGATTCTCCCTGCGCTACGAGATCTACAAGACTGATGTGAAGACAAGCAACACATTTCCTTTAGCTGTTTGCTTTCGTCACTCAGTGGTCTCGGCGTTTATGTGTGAAGTCTCACTTGGTCTTGCCCCTTGATTGATGGTTGATTGGAGCAAGCTGGTTTTTGAGGGTCACGAGTGGCTCAGGTTGATTTTTGCGGTGCTCTTGTTACGCTGTAAATCTCGTTAGCGGAATGACCTCCTGCGACCTTTAACTCGCGGTTCCAGAAGGTCACGGCTCCTCCGTCCTGCTGCAAGGCCGTCAGACACGCTGATTCGTAAATGTTCCCTCAAAGTTTCCGAAATGCTCCCAGACCAATTAAACATCAAGGGAGAGAAGAAAAGAAAATAAA

Function

symbol description
nrp2b Predicted to enable heparin binding activity; metal ion binding activity; and transmembrane signaling receptor activity. Acts upstream of or within several processes, including axon development; neural crest cell migration; and vasculogenesis. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in several structures, including head; mesoderm; nervous system; neural crest cell; and neural plate. Orthologous to human NRP2 (neuropilin 2).
nrp2a Enables identical protein binding activity. Acts upstream of or within neural crest cell migration; regulation of vascular endothelial growth factor receptor signaling pathway; and vasculogenesis. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in axial vasculature; cranial neural crest cell; fin bud; and nervous system. Orthologous to human NRP2 (neuropilin 2).
nrp2 Enables identical protein binding activity. Predicted to be involved in nervous system development and outflow tract septum morphogenesis. Predicted to act upstream of or within several processes, including axon guidance; cellular response to leukemia inhibitory factor; and neural crest cell migration. Predicted to be located in plasma membrane. Predicted to be active in glutamatergic synapse. Predicted to be integral component of postsynaptic membrane.

GO:

id name namespace
GO:0001570 vasculogenesis biological_process

KEGG:

id description
K06819 NRP2; neuropilin 2

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000299_02891830_02905146.mRNA True 714 mRNA 0.51 3 2891574 2905146

Neighbor

gene id symbol gene type direction distance location
CI01000299_02850281_02876863 NRP2A, NRP2 coding downstream 14711 2850281 ~ 2876863 (-)
CI01000299_02833341_02845817 NA coding downstream 45704 2833090 ~ 2845870 (-)
CI01000299_02761916_02788258 FN1B coding downstream 103137 2761414 ~ 2788437 (-)
CI01000299_02723315_02728716 MNX2B coding downstream 162821 2723220 ~ 2728753 (-)
CI01000299_02670695_02682116 NA coding downstream 209458 2670596 ~ 2682116 (-)
CI01000299_02951402_03057288 PARD3BA coding upstream 46256 2951402 ~ 3057288 (-)
CI01000299_03104921_03106385 NA coding upstream 199459 3104605 ~ 3106385 (-)
CI01000299_03206204_03214303 MDH1B coding upstream 301039 3206185 ~ 3214303 (-)
CI01000299_03341031_03366645 KLF7, KLF7A, KLF7B coding upstream 435620 3340766 ~ 3366728 (-)
CI01000299_03492360_03492614 NA coding upstream 587068 3492214 ~ 3493144 (-)
G406779 NA non-coding downstream 62119 2829217 ~ 2829455 (-)
G406772 NA non-coding downstream 171026 2720213 ~ 2720548 (-)
G406630 NA non-coding downstream 184882 2705521 ~ 2706692 (-)
G406715 NA non-coding downstream 359566 2531792 ~ 2532008 (-)
G406551 NA non-coding downstream 796218 2095043 ~ 2095356 (-)
G406786 NA non-coding upstream 16164 2921310 ~ 2922385 (-)
G406790 NA non-coding upstream 24194 2929340 ~ 2929549 (-)
G406842 NA non-coding upstream 152560 3057706 ~ 3058006 (-)
G406868 NA non-coding upstream 215851 3120997 ~ 3121253 (-)
G406884 NA non-coding upstream 249454 3154600 ~ 3155118 (-)
G405053 NA other downstream 873524 2017687 ~ 2018050 (-)
G404976 NA other downstream 1010586 1855639 ~ 1880988 (-)
G404784 NA other downstream 1231574 1659655 ~ 1660000 (-)
G404372 NA other downstream 1815683 1070607 ~ 1075891 (-)
CI01000299_00670925_00672195 NA other downstream 2218718 670680 ~ 673625 (-)
G407413 NA other upstream 1570848 4475994 ~ 4550721 (-)
CI01000299_04913779_04927715 NA other upstream 2020822 4913373 ~ 4927715 (-)
CI01000299_05428160_05443433 APP, APPA other upstream 2536191 5427661 ~ 5443433 (-)

Expression


Co-expression Network