CI01000299_04122601_04126314 (MLE3, MYLZ3, MYL1)


Basic Information

Item Value
gene id CI01000299_04122601_04126314
gene name MLE3, MYLZ3, MYL1
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 4122601 ~ 4126381 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000299_04122601_04126314.mRNA
GCTGGAGAATTCTCTGCTGACCAGATTGAGGACTTCAAAGAGGCTTTCGGTCTCTTCGACAGAGTTGGTGACAACAAGGTTGCCTACAACCAGATTGCCGACATCATGCGCGCCCTGGGTCAGAACCCCACCAACAAGGATGTGAAGAAAATCCTGGGTGACCCATCTGCTGACGATATGGCCAACAAAAGAATTGACTTTGAGGCTTTCCTGCCAATGTTGAAGACTGTTGACGCCGTCCAGAAGGGTACCTATGATGACTACGTTGAGGGTCTGCGCGTCTTCGACAAAGAGGGCAACGGCACAGTGATGGGCGCTGAGCTGCGTATTGTGCTGTCAACACTGGGTGAGAAGATGACCGAGCCCGAGATTGACTCTCTCATGCAGGGACAGGAGGACGAGAACGGCAGTGTCCACTATGAGGAAGCCACCTCAGGCCTTGTATGGCGAGAATCTTTCCTTAAGCATGTCTGCTTCTCCTCTTACAGCTTTCGTCAAGCACATCATGTCCGTGTAAGAGGCCGTCCGTTGAGGGAGTGGTGAAGAAGGCTGAACTATATCTGCAGACCCCATGGTGTCAGGACATCCACTCTGTTTCGAAGACCAATCA

Function

symbol description
mylz3 Predicted to enable calcium ion binding activity. Is expressed in musculature system; pectoral fin; and somite. Orthologous to human MYL1 (myosin light chain 1).
myl1 Predicted to enable calcium ion binding activity. Acts upstream of or within skeletal muscle tissue development. Is expressed in adaxial cell; fin; musculature system; and somite. Orthologous to human MYL1 (myosin light chain 1).

NR:

description
fast skeletal myosin light chain 3

GO:

id name namespace
GO:0005509 calcium ion binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000299_04122601_04126314.mRNA True 610 mRNA 0.52 5 4122601 4126381

Neighbor

gene id symbol gene type direction distance location
CI01000299_04105476_04115171 LANCL1 coding upstream 7374 4105476 ~ 4115227 (+)
CI01000299_03981006_04059237 ERBB4 coding upstream 63364 3981006 ~ 4059237 (+)
CI01000299_03594891_03678552 ERBB4 coding upstream 442989 3594891 ~ 3679612 (+)
CI01000299_03495286_03498691 NA coding upstream 623872 3494539 ~ 3498729 (+)
CI01000299_03478949_03486009 NA coding upstream 636592 3476088 ~ 3486009 (+)
CI01000299_04131136_04133439 PCNP coding downstream 4679 4131060 ~ 4133941 (+)
CI01000299_04259743_04263032 ENG1B, EN1 coding downstream 132540 4258921 ~ 4263493 (+)
CI01000299_04269257_04269673 NA coding downstream 142086 4268467 ~ 4269765 (+)
CI01000299_04472181_04474247 NA coding downstream 344575 4470956 ~ 4474271 (+)
CI01000299_04480751_04492829 NA coding downstream 354172 4480553 ~ 4493116 (+)
G405568 NA non-coding upstream 6417 4078975 ~ 4116184 (+)
G405797 NA non-coding upstream 45564 4076805 ~ 4077037 (+)
G405569 NA non-coding upstream 57036 4065131 ~ 4065565 (+)
G405578 NA non-coding upstream 209643 3893020 ~ 3912958 (+)
G405742 NA non-coding upstream 338675 3778033 ~ 3783926 (+)
G405573 NA non-coding downstream 2613 4128994 ~ 4129600 (+)
G405577 NA non-coding downstream 53469 4179850 ~ 4196335 (+)
G405815 NA non-coding downstream 93060 4219441 ~ 4219649 (+)
G405817 NA non-coding downstream 96780 4223161 ~ 4223448 (+)
G405818 NA non-coding downstream 98434 4224815 ~ 4225273 (+)
G405609 NA other upstream 967427 3154597 ~ 3155174 (+)
G403972 NA other upstream 3516251 604870 ~ 606350 (+)
G403609 NA other upstream 3711813 364139 ~ 410788 (+)
G403578 NA other upstream 4050330 35462 ~ 72271 (+)
G405842 NA other downstream 169152 4295533 ~ 4320141 (+)
CI01000299_04703290_04704365 NA other downstream 576001 4703071 ~ 4704780 (+)
G406096 NA other downstream 798081 4924462 ~ 4927844 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
bowfin (Amia calva) AMCG00000693 NA coding CM030137.1 CM030137.1 339733 ~ 348410 (-)