G403595


Basic Information

Item Value
gene id G403595
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 60419 ~ 162795 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU463914
CTTGATTGGCCAGCAAACTCACCTGACCTTAACCCCATAGAAAATCTATGGGGTATTGTGAAGAGGAAGATGCGATATGCCAGACCCAACAATGCAGAAGAGCTGAAGGCCACTATCAGAGCAACCTGAGCTCTTATAACACCTGAGCAGTGCCACAGACTGATCGACTCCATGCCACGCCGCATTGCTGCAGTAATTCAGGCAAAAGGAGCCCCAACTAAGTATTGAGTGCTGTACATGCTCATACTTTTCATGTTCATACTTTTCGGTTGGCCAAGATT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU463914 True 281 lncRNA 0.47 2 60419 162795

Neighbor

gene id symbol gene type direction distance location
CI01000299_00042567_00045857 NA coding upstream 14228 42454 ~ 46191 (+)
CI01000299_00013442_00032151 NA coding upstream 27345 12783 ~ 33074 (+)
CI01000299_00005753_00010092 NA coding upstream 50194 5635 ~ 10225 (+)
CI01000299_00255175_00294177 MBNL2 coding downstream 92380 255175 ~ 294177 (+)
CI01000299_00315123_00328550 RAP2B, RAP2C, RAP2A, RAP2AB, RAP2A.S coding downstream 152328 315123 ~ 330163 (+)
CI01000299_00345042_00361660 KPNB3, IPO5.L, IPO5.S, IPO5 coding downstream 182247 345042 ~ 362086 (+)
CI01000299_00419297_00444862 NA coding downstream 256502 419297 ~ 445888 (+)
CI01000299_00689032_00727635 NA coding downstream 526111 688906 ~ 727836 (+)
G403952 NA non-coding downstream 387706 550501 ~ 550742 (+)
G403965 NA non-coding downstream 419961 582756 ~ 583123 (+)
G403971 NA non-coding downstream 440037 602832 ~ 603583 (+)
G404016 NA non-coding downstream 486620 649415 ~ 649814 (+)
G404137 NA non-coding downstream 907813 1070608 ~ 1075893 (+)
G403609 NA other downstream 201344 364139 ~ 410788 (+)
G403972 NA other downstream 442075 604870 ~ 606350 (+)
G405609 NA other downstream 2991802 3154597 ~ 3155174 (+)
CI01000299_04131136_04133439 PCNP other downstream 3968463 4131060 ~ 4133941 (+)
G405842 NA other downstream 4132738 4295533 ~ 4320141 (+)

Expression


Co-expression Network