G403738



Basic Information


Item Value
gene id G403738
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 240213 ~ 240461 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU464099
GAATAACGAAGCCTCCTTTCTCTTCACGTCGCACTCTCGCTCCCGCTCAGTTTATGTGCACCTGGTGCGGCAATCAGACTCCTTCACTTCACGCTCTCCCGGTATATAACGACCATGTAAACCGTTGTCATTCCCTATGCGAAGCTGTGAGCTGGCGGCCCATGCCGAGACGGGGATTTTCTCTCAGCAACAGCGCAGAAAGGACCAGCGCGTCTGCTTGCTGCTCAACTATCTGGCTGAAACATTTCC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU464099 True 249 lncRNA 0.54 1 240213 240461

Neighbor


gene id symbol gene type direction distance location
CI01000299_00185106_00209299 NA coding downstream 30914 184774 ~ 209299 (-)
CI01000299_00169255_00170695 NA coding downstream 69227 169223 ~ 170986 (-)
CI01000299_00448948_00449565 NA coding upstream 208402 448863 ~ 449757 (-)
CI01000299_00452374_00452868 NA coding upstream 210880 451341 ~ 452868 (-)
CI01000299_00670925_00672195 NA coding upstream 430219 670680 ~ 673625 (-)
CI01000299_01003547_01034507 NA coding upstream 762858 1003319 ~ 1034812 (-)
CI01000299_01057889_01063623 NA coding upstream 817359 1057820 ~ 1063623 (-)
G403772 NA non-coding downstream 458 239537 ~ 239755 (-)
G403737 NA non-coding downstream 5951 234040 ~ 234262 (-)
G403707 NA non-coding downstream 77297 60302 ~ 162916 (-)
G403773 NA non-coding upstream 689 241150 ~ 242770 (-)
G403774 NA non-coding upstream 2365 242826 ~ 243621 (-)
G403775 NA non-coding upstream 3251 243712 ~ 244005 (-)
G403776 NA non-coding upstream 4129 244590 ~ 245004 (-)
G403777 NA non-coding upstream 5036 245497 ~ 245771 (-)
G404372 NA other upstream 830146 1070607 ~ 1075891 (-)
G404784 NA other upstream 1419194 1659655 ~ 1660000 (-)
G404976 NA other upstream 1615178 1855639 ~ 1880988 (-)
G405053 NA other upstream 1777226 2017687 ~ 2018050 (-)

Expression



Co-expression Network