G403866


Basic Information

Item Value
gene id G403866
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 466674 ~ 466935 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU464258
AAAACATAATTAAGTGTAATTTAAGTGTTTGTATAAATAAGTTAATTTTAACCTTCATTAATATAGTAAAGTAGTACCAACTGCCTCCCATGTGTAGTTTACAGCATTAGTTGAGAGATTTTTTTTCCTCTAGAAAATTTGCCATGTACTGTAACTGATAAACTACATCCAAAATAATCGATATCAAATCGAATCGAAATCGAATCGAATCGTGAAAATTGTGTCAATACCCAGCCCTATTACTCATACATAGTTATATACC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU464258 True 262 lncRNA 0.30 1 466674 466935

Neighbor

gene id symbol gene type direction distance location
CI01000299_00452374_00452868 NA coding downstream 13806 451341 ~ 452868 (-)
CI01000299_00448948_00449565 NA coding downstream 16917 448863 ~ 449757 (-)
CI01000299_00185106_00209299 NA coding downstream 257375 184774 ~ 209299 (-)
CI01000299_00169255_00170695 NA coding downstream 295688 169223 ~ 170986 (-)
CI01000299_00670925_00672195 NA coding upstream 203745 670680 ~ 673625 (-)
CI01000299_01003547_01034507 NA coding upstream 536384 1003319 ~ 1034812 (-)
CI01000299_01057889_01063623 NA coding upstream 590885 1057820 ~ 1063623 (-)
CI01000299_01114487_01122666 NA coding upstream 646815 1113750 ~ 1124230 (-)
CI01000299_01222994_01268707 NA coding upstream 755924 1222859 ~ 1270326 (-)
G403838 NA non-coding downstream 20195 444789 ~ 446479 (-)
G403841 NA non-coding downstream 27888 438309 ~ 438786 (-)
G403840 NA non-coding downstream 33085 433359 ~ 433589 (-)
G403858 NA non-coding downstream 36709 429635 ~ 429965 (-)
G403857 NA non-coding downstream 37245 428433 ~ 429429 (-)
G403867 NA non-coding upstream 215 467150 ~ 467350 (-)
G403874 NA non-coding upstream 11035 477970 ~ 478252 (-)
G403875 NA non-coding upstream 11609 478544 ~ 479150 (-)
G403913 NA non-coding upstream 58586 525521 ~ 525854 (-)
G404161 NA non-coding upstream 88509 555444 ~ 555651 (-)
G404372 NA other upstream 603672 1070607 ~ 1075891 (-)
G404784 NA other upstream 1192720 1659655 ~ 1660000 (-)
G404976 NA other upstream 1388704 1855639 ~ 1880988 (-)
G405053 NA other upstream 1550752 2017687 ~ 2018050 (-)

Expression


Co-expression Network