G404168



Basic Information


Item Value
gene id G404168
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 596568 ~ 601001 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU464578
CACAGATGGTGTGGATCAGGGTCAACAGAGATGACCTCGGCCTCCGCTCGGCCTGCTGGGAACTCTGAGAGGCAGCTGAGCTCTAAGACCTCCAATACACACAGATCAGACTCCATCTATTCAAAGCCTCCGAAGAATCAACCTCAGAAGAGATTTACCACTTTACTGCCACTCAGGGAATGGTCCTAAGCCACAACCCCGAGGGACGTCCCACTCTCGTAGTTATCCAGAGTGCTGTACAGAAAGGTTTTACCCTCCTCCTCCTCTGAAC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU464578 True 271 lncRNA 0.52 2 596568 601001

Neighbor


gene id symbol gene type direction distance location
CI01000299_00452374_00452868 NA coding downstream 143700 451341 ~ 452868 (-)
CI01000299_00448948_00449565 NA coding downstream 146811 448863 ~ 449757 (-)
CI01000299_00185106_00209299 NA coding downstream 387269 184774 ~ 209299 (-)
CI01000299_00169255_00170695 NA coding downstream 425582 169223 ~ 170986 (-)
CI01000299_00670925_00672195 NA coding upstream 69679 670680 ~ 673625 (-)
CI01000299_01003547_01034507 NA coding upstream 402318 1003319 ~ 1034812 (-)
CI01000299_01057889_01063623 NA coding upstream 456819 1057820 ~ 1063623 (-)
CI01000299_01114487_01122666 NA coding upstream 512749 1113750 ~ 1124230 (-)
CI01000299_01222994_01268707 NA coding upstream 621858 1222859 ~ 1270326 (-)
G404166 NA non-coding downstream 10221 586146 ~ 586347 (-)
G404162 NA non-coding downstream 40505 555853 ~ 556063 (-)
G404161 NA non-coding downstream 40917 555444 ~ 555651 (-)
G403913 NA non-coding downstream 70714 525521 ~ 525854 (-)
G403875 NA non-coding downstream 117418 478544 ~ 479150 (-)
G404169 NA non-coding upstream 4072 605073 ~ 605582 (-)
G404293 NA non-coding upstream 524735 1125736 ~ 1127433 (-)
G404380 NA non-coding upstream 530042 1131043 ~ 1131262 (-)
G404457 NA non-coding upstream 546455 1147456 ~ 1147727 (-)
G404372 NA other upstream 469606 1070607 ~ 1075891 (-)
G404784 NA other upstream 1058654 1659655 ~ 1660000 (-)
G404976 NA other upstream 1254638 1855639 ~ 1880988 (-)
G405053 NA other upstream 1416686 2017687 ~ 2018050 (-)

Expression



Co-expression Network