G404169


Basic Information

Item Value
gene id G404169
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 605073 ~ 605582 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU464580
GTGTCCGTGGCGGCCTGACAAATTCTGATGTTTCGCCATGAAAGAGGAAGCTGTTGTAACTCAGGCATACAATGTCCGATCTGCCCCAAACTTCACATGTGTGATAAGAGTCCTGGCCTAAAGACATCTATATGCCAATATTCAGTTAGTCATAGCGCCACCTGCTGGCAACAGAAAATGGCATGCTTTACACTGTAATTCACTCCCAGAAACACATTTCAATATGCCACAAAGTACCAAACACAGTAGAAACAGGTTAAATCATGCAACACTTGGCTAAGTGCTAATGTATGCGATTAACGCCACGAAATAATAGTCCCAGTTCGATAATAGTCCTGGCCTGAAGTCATCTACATGGCAATATTCAGTTACGGTCAAAGCGCCACCTGTTGGCAGCAGGAAGTCTGGCACTTTGAAATGACTTGGCCATAATTCTCCTGTATTTACTCGCTTACATGCATGTCGCCCACTGTTCACTGTTTTCCTAAGGCCAACGGTTGGCGGTGAGCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU464580 True 510 lncRNA 0.45 1 605073 605582

Neighbor

gene id symbol gene type direction distance location
CI01000299_00452374_00452868 NA coding downstream 152205 451341 ~ 452868 (-)
CI01000299_00448948_00449565 NA coding downstream 155316 448863 ~ 449757 (-)
CI01000299_00185106_00209299 NA coding downstream 395774 184774 ~ 209299 (-)
CI01000299_00169255_00170695 NA coding downstream 434087 169223 ~ 170986 (-)
CI01000299_00670925_00672195 NA coding upstream 65098 670680 ~ 673625 (-)
CI01000299_01003547_01034507 NA coding upstream 397737 1003319 ~ 1034812 (-)
CI01000299_01057889_01063623 NA coding upstream 452238 1057820 ~ 1063623 (-)
CI01000299_01114487_01122666 NA coding upstream 508168 1113750 ~ 1124230 (-)
CI01000299_01222994_01268707 NA coding upstream 617277 1222859 ~ 1270326 (-)
G404168 NA non-coding downstream 4072 596568 ~ 601001 (-)
G404166 NA non-coding downstream 18726 586146 ~ 586347 (-)
G404162 NA non-coding downstream 49010 555853 ~ 556063 (-)
G404161 NA non-coding downstream 49422 555444 ~ 555651 (-)
G403913 NA non-coding downstream 79219 525521 ~ 525854 (-)
G404293 NA non-coding upstream 520154 1125736 ~ 1127433 (-)
G404380 NA non-coding upstream 525461 1131043 ~ 1131262 (-)
G404457 NA non-coding upstream 541874 1147456 ~ 1147727 (-)
G404484 NA non-coding upstream 591859 1197441 ~ 1198241 (-)
G404372 NA other upstream 465025 1070607 ~ 1075891 (-)
G404784 NA other upstream 1054073 1659655 ~ 1660000 (-)
G404976 NA other upstream 1250057 1855639 ~ 1880988 (-)
G405053 NA other upstream 1412105 2017687 ~ 2018050 (-)

Expression


Co-expression Network