G404016


Basic Information

Item Value
gene id G404016
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 649415 ~ 649814 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU464416
AAAATTAGACAAAAAAACCCAACCGCACCAAAAAAACAATCAAACAAATGAGACAAAAACATATAATTTGTCAACCTTTTCCAGTCTGATGAACAACAACAACTCTTTTTCTGAAGTCCTCAGGAATCTCCTTTGTCCGTGCCTTGATACACCTCCACAAACAAACTTTGCTAAAATCCCTGAAACTTTGTGAAACTTTGCTAGATCCCTGTTCTTTAAATAAAACAAGGCACAAACTGACACCTGATTGTCATCCCATTGATTGAAAACATCTAAGAACAGGTGGAGCCTAATTTCACCTTCAAATTAACTGCTAATCCTAGAGCTTCACTAAAGACTATAGATTCAGAAAGATGGTTCACTTCTATTAGTTATGAATGAAAGAAATTTCAACATGCAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU464416 True 400 lncRNA 0.35 1 649415 649814

Neighbor

gene id symbol gene type direction distance location
CI01000299_00419297_00444862 NA coding upstream 203527 419297 ~ 445888 (+)
CI01000299_00345042_00361660 KPNB3, IPO5.L, IPO5.S, IPO5 coding upstream 287329 345042 ~ 362086 (+)
CI01000299_00315123_00328550 RAP2B, RAP2C, RAP2A, RAP2AB, RAP2A.S coding upstream 319252 315123 ~ 330163 (+)
CI01000299_00255175_00294177 MBNL2 coding upstream 355238 255175 ~ 294177 (+)
CI01000299_00151569_00153623 SLC5A3A coding upstream 494943 151519 ~ 154472 (+)
CI01000299_00689032_00727635 NA coding downstream 39092 688906 ~ 727836 (+)
CI01000299_00795673_00796901 GPC6 coding downstream 145859 795673 ~ 797157 (+)
CI01000299_00826470_00828773 NA coding downstream 176619 826433 ~ 828960 (+)
CI01000299_00862803_00911972 GPC6A, GPC6 coding downstream 212989 862803 ~ 911972 (+)
CI01000299_01036243_01046776 NA coding downstream 385223 1035037 ~ 1047603 (+)
G403971 NA non-coding upstream 45832 602832 ~ 603583 (+)
G403965 NA non-coding upstream 66292 582756 ~ 583123 (+)
G403952 NA non-coding upstream 98673 550501 ~ 550742 (+)
G403595 NA non-coding upstream 486620 60419 ~ 162795 (+)
G404137 NA non-coding downstream 420794 1070608 ~ 1075893 (+)
G404074 NA non-coding downstream 473765 1123579 ~ 1125274 (+)
G404075 NA non-coding downstream 475926 1125740 ~ 1127444 (+)
G404385 NA non-coding downstream 491542 1141356 ~ 1141636 (+)
G404424 NA non-coding downstream 545663 1195477 ~ 1195736 (+)
G403972 NA other upstream 43065 604870 ~ 606350 (+)
G403609 NA other upstream 238627 364139 ~ 410788 (+)
G403578 NA other upstream 577144 35462 ~ 72271 (+)
G405609 NA other downstream 2504783 3154597 ~ 3155174 (+)
CI01000299_04131136_04133439 PCNP other downstream 3481444 4131060 ~ 4133941 (+)
G405842 NA other downstream 3645719 4295533 ~ 4320141 (+)
CI01000299_04480751_04492829 NA other downstream 3840004 4480553 ~ 4493116 (+)
CI01000299_04703290_04704365 NA other downstream 4052568 4703071 ~ 4704780 (+)

Expression


Co-expression Network