G404293



Basic Information


Item Value
gene id G404293
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 1125736 ~ 1127433 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU464713
GGGAGCCGCCCTTCATTCACCCACATGGTTCACGGCAGGTCGCGTTCGCGCCACTTTTGCAATTTTACTATGATTAAGAAAGTCGTTTAAGGAGAAGTTTCACTTTGCTTTGGACTCGCGCCGCGTGCGTTACATTCGATCGCGGTCTACTTTTAAGTTTACGCACCAGTTTCGCAGATTTGTCCAGAGCAGTGGCAGTAAACGGCAAGTGAGTGAAGATGGTGGATTTCACTGAAACCTCAAAGATGGGAGTAGCTCCCCGCAAGTTCTTTGGAGACTTTCATCCATTGGACTTTGTTGATGTGAAATATGAGATGGACGTGGTTGGTGTC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU464713 True 332 lncRNA 0.48 2 1125736 1127433

Neighbor


gene id symbol gene type direction distance location
CI01000299_01114487_01122666 NA coding downstream 1506 1113750 ~ 1124230 (-)
CI01000299_01057889_01063623 NA coding downstream 62113 1057820 ~ 1063623 (-)
CI01000299_01003547_01034507 NA coding downstream 90924 1003319 ~ 1034812 (-)
CI01000299_00670925_00672195 NA coding downstream 452111 670680 ~ 673625 (-)
CI01000299_00452374_00452868 NA coding downstream 672868 451341 ~ 452868 (-)
CI01000299_01222994_01268707 NA coding upstream 95426 1222859 ~ 1270326 (-)
CI01000299_01338052_01368900 NA coding upstream 210439 1337872 ~ 1369376 (-)
CI01000299_01419938_01421048 NA coding upstream 292096 1419529 ~ 1421048 (-)
CI01000299_01693958_01696561 SLITRK5 coding upstream 565491 1692924 ~ 1697305 (-)
CI01000299_02670695_02682116 NA coding upstream 1543163 2670596 ~ 2682116 (-)
G404169 NA non-coding downstream 520154 605073 ~ 605582 (-)
G404168 NA non-coding downstream 524735 596568 ~ 601001 (-)
G404166 NA non-coding downstream 539389 586146 ~ 586347 (-)
G404162 NA non-coding downstream 569673 555853 ~ 556063 (-)
G404380 NA non-coding upstream 3610 1131043 ~ 1131262 (-)
G404457 NA non-coding upstream 20023 1147456 ~ 1147727 (-)
G404484 NA non-coding upstream 70008 1197441 ~ 1198241 (-)
G404486 NA non-coding upstream 71924 1199357 ~ 1200671 (-)
G404493 NA non-coding upstream 84274 1211707 ~ 1211930 (-)
G404372 NA other downstream 49845 1070607 ~ 1075891 (-)
G404784 NA other upstream 532222 1659655 ~ 1660000 (-)
G404976 NA other upstream 728206 1855639 ~ 1880988 (-)
G405053 NA other upstream 890254 2017687 ~ 2018050 (-)
G407413 NA other upstream 3348561 4475994 ~ 4550721 (-)

Expression



Co-expression Network