G404486



Basic Information


Item Value
gene id G404486
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 1199357 ~ 1200671 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU464918
ATCAATGATGGCACAACATCGCACAGCTTCTGGTTGTGAAACTGATAGCTCTGGCCCTCACATAACCTCCCCTCTTGATTTTGAGCCACACTTCTTTGGAGCTGCACACACACTCTTTTTAGTTTGTTTGAGGCTGATAGTGCAGACGAGGAGGAACACAAAAGCAGGTGATGAGAAAGCAGGAGACTGCATTAAAACAAACAGTCACCGTGTGCTCTGAAAAACATCACATTTTTGAAGCACATCACATCGATTCTGGAAACACAATGTTCGATTCCCTGCTGTAAGAAAAAAGGCACCGG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU464918 True 302 lncRNA 0.45 2 1199357 1200671

Neighbor


gene id symbol gene type direction distance location
CI01000299_01114487_01122666 NA coding downstream 75127 1113750 ~ 1124230 (-)
CI01000299_01057889_01063623 NA coding downstream 135734 1057820 ~ 1063623 (-)
CI01000299_01003547_01034507 NA coding downstream 164545 1003319 ~ 1034812 (-)
CI01000299_00670925_00672195 NA coding downstream 525732 670680 ~ 673625 (-)
CI01000299_00452374_00452868 NA coding downstream 746489 451341 ~ 452868 (-)
CI01000299_01222994_01268707 NA coding upstream 22188 1222859 ~ 1270326 (-)
CI01000299_01338052_01368900 NA coding upstream 137201 1337872 ~ 1369376 (-)
CI01000299_01419938_01421048 NA coding upstream 218858 1419529 ~ 1421048 (-)
CI01000299_01693958_01696561 SLITRK5 coding upstream 492253 1692924 ~ 1697305 (-)
CI01000299_02670695_02682116 NA coding upstream 1469925 2670596 ~ 2682116 (-)
G404484 NA non-coding downstream 1116 1197441 ~ 1198241 (-)
G404457 NA non-coding downstream 51630 1147456 ~ 1147727 (-)
G404380 NA non-coding downstream 68095 1131043 ~ 1131262 (-)
G404293 NA non-coding downstream 71924 1125736 ~ 1127433 (-)
G404493 NA non-coding upstream 11036 1211707 ~ 1211930 (-)
G404541 NA non-coding upstream 108883 1309554 ~ 1309772 (-)
G404604 NA non-coding upstream 203243 1403914 ~ 1404355 (-)
G404669 NA non-coding upstream 266170 1466841 ~ 1500623 (-)
G404771 NA non-coding upstream 403629 1604300 ~ 1604628 (-)
G404372 NA other downstream 123466 1070607 ~ 1075891 (-)
G404784 NA other upstream 458984 1659655 ~ 1660000 (-)
G404976 NA other upstream 654968 1855639 ~ 1880988 (-)
G405053 NA other upstream 817016 2017687 ~ 2018050 (-)
G407413 NA other upstream 3275323 4475994 ~ 4550721 (-)

Expression



Co-expression Network