G404777


Basic Information

Item Value
gene id G404777
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 1631896 ~ 1632336 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU465218
ATATCATCCAAAGATTCAGAGAATCTGGAACAATCTCTGTGCGTAAGGGTCAAGGCCAGAAAACCATACTAGATGCCCGTGATCTTCGGGCCCTTAGACGGCACTGCATCACATACAGGAATGCTACTGTAATGGAAATCACAACATGGGCTCAGGAATACTTCCAGAAAACATTGTCGGTGAACACAATCCACCGTGCCATTCGCCGTTGCCGGCTAAAACTCTATAGGTCAAAAAAGAAGCCATATCTAAACTTGATCCAGAAGCGCAGGCGTTTTCTCTGGGCCAAGGCTCATTTAAAATGGACAGTGGCAAAGTGGAACACTGTTCTGTGGTCAGACGAATGAAAATTTGAAGTTCTTTTTGGAAAACTGGGACGCCATGTCATCCGGACTAAAGAGGACAAGGACAACCCAAGTTGTTATCAGCGCTCAGTTCAGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU465218 True 441 lncRNA 0.46 1 1631896 1632336

Neighbor

gene id symbol gene type direction distance location
CI01000299_01419938_01421048 NA coding downstream 210848 1419529 ~ 1421048 (-)
CI01000299_01338052_01368900 NA coding downstream 262520 1337872 ~ 1369376 (-)
CI01000299_01222994_01268707 NA coding downstream 361570 1222859 ~ 1270326 (-)
CI01000299_01114487_01122666 NA coding downstream 507666 1113750 ~ 1124230 (-)
CI01000299_01057889_01063623 NA coding downstream 568273 1057820 ~ 1063623 (-)
CI01000299_01693958_01696561 SLITRK5 coding upstream 60588 1692924 ~ 1697305 (-)
CI01000299_02670695_02682116 NA coding upstream 1038260 2670596 ~ 2682116 (-)
CI01000299_02723315_02728716 MNX2B coding upstream 1090884 2723220 ~ 2728753 (-)
CI01000299_02761916_02788258 FN1B coding upstream 1129078 2761414 ~ 2788437 (-)
CI01000299_02833341_02845817 NA coding upstream 1200754 2833090 ~ 2845870 (-)
G404772 NA non-coding downstream 26788 1604710 ~ 1605108 (-)
G404771 NA non-coding downstream 27268 1604300 ~ 1604628 (-)
G404669 NA non-coding downstream 131273 1466841 ~ 1500623 (-)
G404604 NA non-coding downstream 227541 1403914 ~ 1404355 (-)
G404541 NA non-coding downstream 322124 1309554 ~ 1309772 (-)
G404778 NA non-coding upstream 3341 1635677 ~ 1635957 (-)
G404765 NA non-coding upstream 53711 1686047 ~ 1691281 (-)
G404800 NA non-coding upstream 73691 1706027 ~ 1706240 (-)
G405049 NA non-coding upstream 373840 2006176 ~ 2006729 (-)
G405051 NA non-coding upstream 384748 2017084 ~ 2017314 (-)
G404372 NA other downstream 556005 1070607 ~ 1075891 (-)
CI01000299_00670925_00672195 NA other downstream 959040 670680 ~ 673625 (-)
G404784 NA other upstream 27319 1659655 ~ 1660000 (-)
G404976 NA other upstream 223303 1855639 ~ 1880988 (-)
G405053 NA other upstream 385351 2017687 ~ 2018050 (-)
G407413 NA other upstream 2843658 4475994 ~ 4550721 (-)

Expression


Co-expression Network