G406715


Basic Information

Item Value
gene id G406715
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 2531792 ~ 2532008 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU467344
CCGCAGACGAGCGCTTCTGCTTCTTCTGGTCAAGCGTATGTGGGGTAAAGCAGTGCTGTTCATCATATTAGATACATTCGTGTGTTGAAAGTTGTTATAATGCTACTCTGTGCGTTCACTCTGCGGCTGCTATGAGACACTTGTTGCACACTGCAGTAAGCTAGACTGATATTAGGCATGGTAAAACATGGTACTCGTGGTAAATCAAGAAAACGAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU467344 True 217 lncRNA 0.45 1 2531792 2532008

Neighbor

gene id symbol gene type direction distance location
CI01000299_01693958_01696561 SLITRK5 coding downstream 834487 1692924 ~ 1697305 (-)
CI01000299_01419938_01421048 NA coding downstream 1110744 1419529 ~ 1421048 (-)
CI01000299_01338052_01368900 NA coding downstream 1162416 1337872 ~ 1369376 (-)
CI01000299_01222994_01268707 NA coding downstream 1261466 1222859 ~ 1270326 (-)
CI01000299_01114487_01122666 NA coding downstream 1407562 1113750 ~ 1124230 (-)
CI01000299_02670695_02682116 NA coding upstream 138588 2670596 ~ 2682116 (-)
CI01000299_02723315_02728716 MNX2B coding upstream 191212 2723220 ~ 2728753 (-)
CI01000299_02761916_02788258 FN1B coding upstream 229406 2761414 ~ 2788437 (-)
CI01000299_02833341_02845817 NA coding upstream 301082 2833090 ~ 2845870 (-)
CI01000299_02850281_02876863 NRP2A, NRP2 coding upstream 318273 2850281 ~ 2876863 (-)
G406551 NA non-coding downstream 436436 2095043 ~ 2095356 (-)
G406539 NA non-coding downstream 473906 2057670 ~ 2057886 (-)
G405068 NA non-coding downstream 501355 2030201 ~ 2030437 (-)
G405067 NA non-coding downstream 501741 2029605 ~ 2030051 (-)
G405051 NA non-coding downstream 514478 2017084 ~ 2017314 (-)
G406630 NA non-coding upstream 173513 2705521 ~ 2706692 (-)
G406772 NA non-coding upstream 188205 2720213 ~ 2720548 (-)
G406779 NA non-coding upstream 297209 2829217 ~ 2829455 (-)
G406786 NA non-coding upstream 389302 2921310 ~ 2922385 (-)
G406790 NA non-coding upstream 397332 2929340 ~ 2929549 (-)
G405053 NA other downstream 513742 2017687 ~ 2018050 (-)
G404976 NA other downstream 650804 1855639 ~ 1880988 (-)
G404784 NA other downstream 871792 1659655 ~ 1660000 (-)
G404372 NA other downstream 1455901 1070607 ~ 1075891 (-)
CI01000299_00670925_00672195 NA other downstream 1858936 670680 ~ 673625 (-)
G407413 NA other upstream 1943986 4475994 ~ 4550721 (-)
CI01000299_04913779_04927715 NA other upstream 2393960 4913373 ~ 4927715 (-)
CI01000299_05428160_05443433 APP, APPA other upstream 2909329 5427661 ~ 5443433 (-)

Expression


Co-expression Network