G406790


Basic Information

Item Value
gene id G406790
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 2929340 ~ 2929549 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU467422
CCCTATTTTAACAATCTAAACTCATGGTCTGAAGCGCATGGCACAGGTGCCCTTAGGGCGTGTCTGAATCCACTTTTGCTAGTTTAATGATGGAAAAAATGGTTGGTGCACTAGGCGCATGGTCTAGTCTCTTAATGAGTCATGGGTGTGTTTTGGGCGTAACGTGCAATAAACCAATCAGAGTCTCATCTCCCATTCCCTTTAAAAGCC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU467422 True 210 lncRNA 0.45 1 2929340 2929549

Neighbor

gene id symbol gene type direction distance location
CI01000299_02891830_02905146 NRP2B, NRP2A, NRP2 coding downstream 24194 2891574 ~ 2905146 (-)
CI01000299_02850281_02876863 NRP2A, NRP2 coding downstream 52477 2850281 ~ 2876863 (-)
CI01000299_02833341_02845817 NA coding downstream 83470 2833090 ~ 2845870 (-)
CI01000299_02761916_02788258 FN1B coding downstream 140903 2761414 ~ 2788437 (-)
CI01000299_02723315_02728716 MNX2B coding downstream 200587 2723220 ~ 2728753 (-)
CI01000299_02951402_03057288 PARD3BA coding upstream 21853 2951402 ~ 3057288 (-)
CI01000299_03104921_03106385 NA coding upstream 175056 3104605 ~ 3106385 (-)
CI01000299_03206204_03214303 MDH1B coding upstream 276636 3206185 ~ 3214303 (-)
CI01000299_03341031_03366645 KLF7, KLF7A, KLF7B coding upstream 411217 3340766 ~ 3366728 (-)
CI01000299_03492360_03492614 NA coding upstream 562665 3492214 ~ 3493144 (-)
G406786 NA non-coding downstream 6955 2921310 ~ 2922385 (-)
G406779 NA non-coding downstream 99885 2829217 ~ 2829455 (-)
G406772 NA non-coding downstream 208792 2720213 ~ 2720548 (-)
G406630 NA non-coding downstream 222648 2705521 ~ 2706692 (-)
G406715 NA non-coding downstream 397332 2531792 ~ 2532008 (-)
G406842 NA non-coding upstream 128157 3057706 ~ 3058006 (-)
G406868 NA non-coding upstream 191448 3120997 ~ 3121253 (-)
G406884 NA non-coding upstream 225051 3154600 ~ 3155118 (-)
G406858 NA non-coding upstream 228847 3158396 ~ 3204366 (-)
G406889 NA non-coding upstream 236982 3166531 ~ 3169255 (-)
G405053 NA other downstream 911290 2017687 ~ 2018050 (-)
G404976 NA other downstream 1048352 1855639 ~ 1880988 (-)
G404784 NA other downstream 1269340 1659655 ~ 1660000 (-)
G404372 NA other downstream 1853449 1070607 ~ 1075891 (-)
CI01000299_00670925_00672195 NA other downstream 2256484 670680 ~ 673625 (-)
G407413 NA other upstream 1546445 4475994 ~ 4550721 (-)
CI01000299_04913779_04927715 NA other upstream 1996419 4913373 ~ 4927715 (-)
CI01000299_05428160_05443433 APP, APPA other upstream 2511788 5427661 ~ 5443433 (-)

Expression


Co-expression Network