G406932


Basic Information

Item Value
gene id G406932
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 3289462 ~ 3295137 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU467578
CGGGTGATGTCATGACGCACTGAGGGAAGAGAACGCACTGGCTGATGGCCGTTCACTTGAGCACAGGCTCCTGTCTCTCCATCTGTTAGCGTGGCAGCCTGTGCTGCGTCAGCTGCCCCTCTCGCTTCATTGGTTAATTCCATCGCTTCAGCCTGTGATGCGTTTCCTGATGCTTGCAGACTCCGCCTCCTCTGCCAGATTTCAGCATCTTCTTCCTCCTCATTGGCTGCCTCACTGGAGTTCCCCTGCTCTGGCTGCTTAGCTGCTGTGGCTCCGCCTCCTTCACCAGCTGCATTACTGCCAGATGCTGAGGGCTCTGTGACTGCAGCAGCCTCTGTTGATCCTTCATCCCTAGTGACCGCCTTGGATGCAACTCCTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU467578 True 379 lncRNA 0.57 2 3289462 3295137

Neighbor

gene id symbol gene type direction distance location
CI01000299_03206204_03214303 MDH1B coding downstream 75159 3206185 ~ 3214303 (-)
CI01000299_03104921_03106385 NA coding downstream 183077 3104605 ~ 3106385 (-)
CI01000299_02951402_03057288 PARD3BA coding downstream 232174 2951402 ~ 3057288 (-)
CI01000299_02891830_02905146 NRP2B, NRP2A, NRP2 coding downstream 384316 2891574 ~ 2905146 (-)
CI01000299_02850281_02876863 NRP2A, NRP2 coding downstream 412599 2850281 ~ 2876863 (-)
CI01000299_03341031_03366645 KLF7, KLF7A, KLF7B coding upstream 45629 3340766 ~ 3366728 (-)
CI01000299_03492360_03492614 NA coding upstream 197077 3492214 ~ 3493144 (-)
CI01000299_04136702_04142005 NA coding upstream 839683 4134820 ~ 4142125 (-)
CI01000299_04158468_04164223 MX2, MX1, MXB, MX, MXA coding upstream 862864 4158001 ~ 4164715 (-)
CI01000299_04171373_04175441 NA coding upstream 876012 4171149 ~ 4175441 (-)
G406912 NA non-coding downstream 49614 3239309 ~ 3239848 (-)
G406858 NA non-coding downstream 85096 3158396 ~ 3204366 (-)
G406862 NA non-coding downstream 92463 3196293 ~ 3196999 (-)
G406872 NA non-coding downstream 113541 3174373 ~ 3175921 (-)
G406889 NA non-coding downstream 120207 3166531 ~ 3169255 (-)
G406942 NA non-coding upstream 8615 3303752 ~ 3305190 (-)
G406941 NA non-coding upstream 17246 3312383 ~ 3316446 (-)
G406927 NA non-coding upstream 38906 3334043 ~ 3335207 (-)
G406928 NA non-coding upstream 78783 3373920 ~ 3401249 (-)
G406971 NA non-coding upstream 119866 3415003 ~ 3415287 (-)
G405053 NA other downstream 1271412 2017687 ~ 2018050 (-)
G404976 NA other downstream 1408474 1855639 ~ 1880988 (-)
G404784 NA other downstream 1629462 1659655 ~ 1660000 (-)
G404372 NA other downstream 2213571 1070607 ~ 1075891 (-)
CI01000299_00670925_00672195 NA other downstream 2616606 670680 ~ 673625 (-)
G407413 NA other upstream 1180857 4475994 ~ 4550721 (-)
CI01000299_04913779_04927715 NA other upstream 1630831 4913373 ~ 4927715 (-)
CI01000299_05428160_05443433 APP, APPA other upstream 2146200 5427661 ~ 5443433 (-)

Expression


Co-expression Network