G407005


Basic Information

Item Value
gene id G407005
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 3462701 ~ 3462913 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU467653
AGAAACCACACAGAACACCCTAGAAGCTGCATTGCAACATGCTAAACATTTAGAATTCTTAAACAACAGCCTAGCAACGCCCTAGCAACCACACAGAACACAATAGAAGCTGCACAGCAACACACTAAAAATATTCCGAATTCTTAAACAGCCTAGCAACACCCTAGAAACCACACAGAACACCTTAGAAGCTGCAATGCAACATGCTAAAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU467653 True 213 lncRNA 0.41 1 3462701 3462913

Neighbor

gene id symbol gene type direction distance location
CI01000299_03341031_03366645 KLF7, KLF7A, KLF7B coding downstream 95973 3340766 ~ 3366728 (-)
CI01000299_03206204_03214303 MDH1B coding downstream 248398 3206185 ~ 3214303 (-)
CI01000299_03104921_03106385 NA coding downstream 356316 3104605 ~ 3106385 (-)
CI01000299_02951402_03057288 PARD3BA coding downstream 405413 2951402 ~ 3057288 (-)
CI01000299_02891830_02905146 NRP2B, NRP2A, NRP2 coding downstream 557555 2891574 ~ 2905146 (-)
CI01000299_03492360_03492614 NA coding upstream 29301 3492214 ~ 3493144 (-)
CI01000299_04136702_04142005 NA coding upstream 671907 4134820 ~ 4142125 (-)
CI01000299_04158468_04164223 MX2, MX1, MXB, MX, MXA coding upstream 695088 4158001 ~ 4164715 (-)
CI01000299_04171373_04175441 NA coding upstream 708236 4171149 ~ 4175441 (-)
CI01000299_04186183_04196219 MX1, MXB, MXA coding upstream 722054 4184967 ~ 4197884 (-)
G406982 NA non-coding downstream 20377 3442088 ~ 3442324 (-)
G406978 NA non-coding downstream 25696 3436787 ~ 3437005 (-)
G406972 NA non-coding downstream 44379 3418084 ~ 3418322 (-)
G406971 NA non-coding downstream 47414 3415003 ~ 3415287 (-)
G406928 NA non-coding downstream 61452 3373920 ~ 3401249 (-)
G407011 NA non-coding upstream 4346 3467259 ~ 3467752 (-)
G407012 NA non-coding upstream 6178 3469091 ~ 3469378 (-)
G407015 NA non-coding upstream 9208 3472121 ~ 3472623 (-)
G407020 NA non-coding upstream 12617 3475530 ~ 3475796 (-)
G407023 NA non-coding upstream 14687 3477600 ~ 3477984 (-)
G405053 NA other downstream 1444651 2017687 ~ 2018050 (-)
G404976 NA other downstream 1581713 1855639 ~ 1880988 (-)
G404784 NA other downstream 1802701 1659655 ~ 1660000 (-)
G404372 NA other downstream 2386810 1070607 ~ 1075891 (-)
CI01000299_00670925_00672195 NA other downstream 2789845 670680 ~ 673625 (-)
G407413 NA other upstream 1013081 4475994 ~ 4550721 (-)
CI01000299_04913779_04927715 NA other upstream 1463055 4913373 ~ 4927715 (-)
CI01000299_05428160_05443433 APP, APPA other upstream 1978424 5427661 ~ 5443433 (-)

Expression


Co-expression Network