G405742


Basic Information

Item Value
gene id G405742
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 3778033 ~ 3783926 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU466246
GGAAGAGTTGTTGTAGTAGAGTGTTGTTGACATGCCATCATTTTACACCAGACTGCTTCACAAACGAGGGTCAATTCAACGCTGGATTTGCACAAAAGATTAACATGACGGCACATGCTAGTCGATGAGTTGAATCAACTTCACAGCAACTACATAAATTTATCCACTAACCATTCAGAAATGTCCTAAAAGTTGTAACTTCTTCCTGAGTCTCTCCATCAGTGTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU466246 True 226 lncRNA 0.40 2 3778033 3783926

Neighbor

gene id symbol gene type direction distance location
CI01000299_03594891_03678552 ERBB4 coding upstream 98421 3594891 ~ 3679612 (+)
CI01000299_03495286_03498691 NA coding upstream 279304 3494539 ~ 3498729 (+)
CI01000299_03478949_03486009 NA coding upstream 292024 3476088 ~ 3486009 (+)
CI01000299_03453437_03453736 NA coding upstream 323824 3452300 ~ 3454209 (+)
CI01000299_03382616_03423028 NA coding upstream 354336 3382491 ~ 3423697 (+)
CI01000299_03981006_04059237 ERBB4 coding downstream 197080 3981006 ~ 4059237 (+)
CI01000299_04105476_04115171 LANCL1 coding downstream 321550 4105476 ~ 4115227 (+)
CI01000299_04122601_04126314 MLE3, MYLZ3, MYL1 coding downstream 338675 4122601 ~ 4126381 (+)
CI01000299_04131136_04133439 PCNP coding downstream 347134 4131060 ~ 4133941 (+)
CI01000299_04259743_04263032 ENG1B, EN1 coding downstream 474995 4258921 ~ 4263493 (+)
G405710 NA non-coding upstream 52853 3698428 ~ 3725180 (+)
G405579 NA non-coding upstream 220930 3552314 ~ 3557103 (+)
G405575 NA non-coding upstream 242335 3505295 ~ 3535698 (+)
G405697 NA non-coding upstream 305418 3472375 ~ 3472615 (+)
G405578 NA non-coding downstream 109094 3893020 ~ 3912958 (+)
G405569 NA non-coding downstream 281205 4065131 ~ 4065565 (+)
G405797 NA non-coding downstream 292879 4076805 ~ 4077037 (+)
G405568 NA non-coding downstream 295049 4078975 ~ 4116184 (+)
G405573 NA non-coding downstream 345068 4128994 ~ 4129600 (+)
G405609 NA other upstream 622859 3154597 ~ 3155174 (+)
G403972 NA other upstream 3171683 604870 ~ 606350 (+)
G403609 NA other upstream 3367245 364139 ~ 410788 (+)
G403578 NA other upstream 3705762 35462 ~ 72271 (+)
G405842 NA other downstream 511607 4295533 ~ 4320141 (+)
CI01000299_04480751_04492829 NA other downstream 705892 4480553 ~ 4493116 (+)
CI01000299_04703290_04704365 NA other downstream 918456 4703071 ~ 4704780 (+)
G406096 NA other downstream 1140536 4924462 ~ 4927844 (+)

Expression


Co-expression Network