G405577


Basic Information

Item Value
gene id G405577
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 4179850 ~ 4196335 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU466069
GTTGTCCTTACCACTACCCCTGGGTAACGCTACTCCTGACAGCGCCTCCAGAACAGAACTCTTTCCTGAGCTTTGGTCTCCAATGACGGCGATGGCAGGCAACGCCAGGTCCTTTTCGACTCCCAAAGACCGTAAATTGTCGATAGTGTCGATGCAAGGGCGGATTTTTTCCTCATAGTGCTGACTGAACGTGTAACTCATTTTCTCCATCCTTAAACAACGTCAGAAAGGTCAAAATATCAGAGAAATACTTCACGTCGATATATCAGGAGCTGTCTGTTCGTGCACTCCTCGATAGGACTGTCTCAGAGTGATGCTGTTTCTTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU466069 True 326 lncRNA 0.48 2 4179850 4196335

Neighbor

gene id symbol gene type direction distance location
CI01000299_04131136_04133439 PCNP coding upstream 46048 4131060 ~ 4133941 (+)
CI01000299_04122601_04126314 MLE3, MYLZ3, MYL1 coding upstream 53469 4122601 ~ 4126381 (+)
CI01000299_04105476_04115171 LANCL1 coding upstream 64623 4105476 ~ 4115227 (+)
CI01000299_03981006_04059237 ERBB4 coding upstream 120613 3981006 ~ 4059237 (+)
CI01000299_03594891_03678552 ERBB4 coding upstream 500238 3594891 ~ 3679612 (+)
CI01000299_04259743_04263032 ENG1B, EN1 coding downstream 62586 4258921 ~ 4263493 (+)
CI01000299_04269257_04269673 NA coding downstream 72132 4268467 ~ 4269765 (+)
CI01000299_04472181_04474247 NA coding downstream 274621 4470956 ~ 4474271 (+)
CI01000299_04480751_04492829 NA coding downstream 284218 4480553 ~ 4493116 (+)
CI01000299_04496757_04504238 NA coding downstream 300051 4496386 ~ 4504483 (+)
G405573 NA non-coding upstream 50250 4128994 ~ 4129600 (+)
G405568 NA non-coding upstream 63666 4078975 ~ 4116184 (+)
G405797 NA non-coding upstream 102813 4076805 ~ 4077037 (+)
G405569 NA non-coding upstream 114285 4065131 ~ 4065565 (+)
G405578 NA non-coding upstream 266892 3893020 ~ 3912958 (+)
G405815 NA non-coding downstream 23106 4219441 ~ 4219649 (+)
G405817 NA non-coding downstream 26826 4223161 ~ 4223448 (+)
G405818 NA non-coding downstream 28480 4224815 ~ 4225273 (+)
G405825 NA non-coding downstream 44525 4240860 ~ 4241092 (+)
G405554 NA non-coding downstream 44866 4241201 ~ 4242968 (+)
G405609 NA other upstream 1024676 3154597 ~ 3155174 (+)
G403972 NA other upstream 3573500 604870 ~ 606350 (+)
G403609 NA other upstream 3769062 364139 ~ 410788 (+)
G403578 NA other upstream 4107579 35462 ~ 72271 (+)
G405842 NA other downstream 99198 4295533 ~ 4320141 (+)
CI01000299_04703290_04704365 NA other downstream 506047 4703071 ~ 4704780 (+)
G406096 NA other downstream 728127 4924462 ~ 4927844 (+)
G406244 NA other downstream 1174846 5371181 ~ 5373579 (+)

Expression


Co-expression Network