G407885



Basic Information


Item Value
gene id G407885
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 6026115 ~ 6026325 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU468667
CTTTAGCGTATTCAGGGCAAACTTGGTACAAATATGGCCTGAGACTACATGCAGTGTTTTGGCACAGCACCACCTACTGGTCAGAAGATATGAAAAATTGCCTTTTTTGCTTATAACTTCTGAATGGTTTGCCCAAAAATCATAAAAGTTAGATTTGGGACATCATGCCGAGTCGAATGATATCCAATTTTCCCATATCGGCCATTTTGGG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU468667 True 211 lncRNA 0.40 1 6026115 6026325

Neighbor


gene id symbol gene type direction distance location
CI01000299_05974659_05985294 NA coding downstream 40509 5974391 ~ 5985606 (-)
CI01000299_05946615_05949088 NA coding downstream 76881 5946333 ~ 5949234 (-)
CI01000299_05927821_05933216 BLZF1 coding downstream 91283 5927314 ~ 5934832 (-)
CI01000299_05919510_05924061 TXNL4B, TXNL4B.S coding downstream 101487 5919128 ~ 5924628 (-)
CI01000299_05896205_05898855 NA coding downstream 127258 5896043 ~ 5898857 (-)
CI01000299_06037407_06054548 TPP2 coding upstream 9892 6036217 ~ 6054548 (-)
CI01000299_06130943_06144384 NA coding upstream 102748 6129073 ~ 6144868 (-)
CI01000299_06145156_06154533 NA coding upstream 118630 6144955 ~ 6154533 (-)
CI01000299_06185794_06195015 GRK1A, GRK1 coding upstream 159163 6185488 ~ 6195015 (-)
CI01000299_06197276_06199730 TFDP1 coding upstream 170281 6196606 ~ 6199730 (-)
G407884 NA non-coding downstream 313 6025025 ~ 6025802 (-)
G407881 NA non-coding downstream 2451 6018542 ~ 6023664 (-)
G407825 NA non-coding downstream 56559 5963680 ~ 5969556 (-)
G407827 NA non-coding downstream 80090 5945375 ~ 5946025 (-)
G407858 NA non-coding downstream 95569 5929639 ~ 5930546 (-)
G407810 NA non-coding upstream 3951 6030276 ~ 6030985 (-)
G407829 NA non-coding upstream 60839 6087164 ~ 6088221 (-)
G407967 NA non-coding upstream 62177 6088502 ~ 6088726 (-)
G407949 NA non-coding upstream 65166 6091491 ~ 6091881 (-)
G407909 NA non-coding upstream 66966 6093291 ~ 6099458 (-)
G407805 NA other downstream 190126 5835889 ~ 5835989 (-)
CI01000299_05428160_05443433 APP, APPA other downstream 570007 5427661 ~ 5443433 (-)
CI01000299_04913779_04927715 NA other downstream 1097297 4913373 ~ 4927715 (-)
G407413 NA other downstream 1475394 4475994 ~ 4550721 (-)
CI01000299_06526127_06532048 CEP97 other upstream 505676 6526127 ~ 6532048 (-)

Expression



Co-expression Network