G408011



Basic Information


Item Value
gene id G408011
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000299
NCBI id null
chromosome length 6567443
location 6441341 ~ 6441631 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU468810
AGTGCTCGGCGAGGGTGATGGACGATCCCTGTCCAGACGCCACGATGCGCACCGTCCGGCCGCTGTCCCCGCAGTCCAGGTGAACGGAAGAGCCGAGCTCAGAGCCGTGGACGGCCAGCGCGTCGGGGAAGCGGAAGGCGTCGCGCGTGCGATCGCGGCAGTAGGACTTGTACCACCACTGGATGACCGGAGTCTGCGTGGAGACGCTGCTGTACTGACACGGCAGAACCACCGACTGGAACAGCATCGCAAAGCGCCGCTCGTCACGAACAGAGACCTGCACGGCCTCAC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU468810 True 291 lncRNA 0.66 1 6441341 6441631

Neighbor


gene id symbol gene type direction distance location
CI01000299_06362136_06376918 NA coding downstream 64106 6362004 ~ 6377235 (-)
CI01000299_06352251_06359190 DUSP27 coding downstream 81138 6351435 ~ 6360203 (-)
CI01000299_06337727_06341840 NA coding downstream 99501 6337139 ~ 6341840 (-)
CI01000299_06320613_06321046 NA coding downstream 120295 6320564 ~ 6321046 (-)
CI01000299_06310939_06311125 NA coding downstream 130112 6310939 ~ 6311229 (-)
CI01000299_06476844_06477950 PRS23, PRSS23 coding upstream 34352 6475983 ~ 6479549 (-)
CI01000299_06497414_06502931 CK073, HIKESHI coding upstream 55525 6497156 ~ 6502931 (-)
CI01000299_06505676_06510021 EED, EED.S, EED.L coding upstream 63926 6505557 ~ 6510144 (-)
CI01000299_06516832_06521405 NA coding upstream 74964 6516595 ~ 6521405 (-)
CI01000299_06522084_06525262 NA coding upstream 80337 6521968 ~ 6525262 (-)
G408010 NA non-coding downstream 871 6440247 ~ 6440470 (-)
G408009 NA non-coding downstream 1605 6439521 ~ 6439736 (-)
G408001 NA non-coding downstream 8574 6417126 ~ 6432767 (-)
G407927 NA non-coding downstream 48985 6392044 ~ 6392356 (-)
G407986 NA non-coding downstream 51697 6389376 ~ 6389644 (-)
G408013 NA non-coding upstream 842 6442473 ~ 6442776 (-)
G407948 NA non-coding upstream 9031 6450662 ~ 6451378 (-)
G407946 NA non-coding upstream 11164 6452795 ~ 6453660 (-)
G407922 NA non-coding upstream 12462 6454093 ~ 6457229 (-)
G407937 NA non-coding upstream 17148 6458779 ~ 6459120 (-)
G407805 NA other downstream 605352 5835889 ~ 5835989 (-)
CI01000299_05428160_05443433 APP, APPA other downstream 985233 5427661 ~ 5443433 (-)
CI01000299_04913779_04927715 NA other downstream 1512523 4913373 ~ 4927715 (-)
G407413 NA other downstream 1890620 4475994 ~ 4550721 (-)
CI01000299_06526127_06532048 CEP97 other upstream 90370 6526127 ~ 6532048 (-)

Expression



Co-expression Network