G418261


Basic Information

Item Value
gene id G418261
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 1179814 ~ 1180017 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU480438
CTTAGTTCTTAGGACAACTTTTATTAACTTTTTTGATCCACTTCAAATGTTGACTACTATATTTATTAATCTGTTATCTAAGTACATGCTTTCATGTCAAGATACTGGAATGCCACCTGTCTCATGCTATTAATAGTGATATATTGTACGTCATGTCTTTTCATTCATTAGTCATATTCATCTCAGGAATGTTGTACTGCAGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU480438 True 204 lncRNA 0.32 1 1179814 1180017

Neighbor

gene id symbol gene type direction distance location
CI01000304_00983004_01018406 NRG1 coding upstream 161121 982912 ~ 1018693 (+)
CI01000304_00962923_00975418 NA coding upstream 204170 962753 ~ 975644 (+)
CI01000304_00933179_00942864 NA coding upstream 235949 931798 ~ 943865 (+)
CI01000304_00884782_00917034 WRN coding upstream 262780 884490 ~ 917034 (+)
CI01000304_00846138_00850133 NA coding upstream 329435 846059 ~ 850379 (+)
CI01000304_01269500_01313976 PPIP5K2 coding downstream 88006 1268023 ~ 1314632 (+)
CI01000304_01323957_01324596 C16H5ORF30, CUNH5ORF30 coding downstream 143940 1323957 ~ 1326322 (+)
CI01000304_01337171_01361506 CHD1 coding downstream 157154 1337171 ~ 1361506 (+)
CI01000304_01366207_01367994 DCP2 coding downstream 186103 1366120 ~ 1368002 (+)
CI01000304_01369056_01372878 DCP2 coding downstream 188579 1368596 ~ 1372972 (+)
G418257 NA non-coding upstream 13216 1166295 ~ 1166598 (+)
G418256 NA non-coding upstream 13621 1165944 ~ 1166193 (+)
G418253 NA non-coding upstream 16683 1162022 ~ 1163131 (+)
G418248 NA non-coding upstream 26242 1153175 ~ 1153572 (+)
G418108 NA non-coding upstream 103089 1064027 ~ 1076725 (+)
G418113 NA non-coding downstream 25574 1205591 ~ 1206410 (+)
G418649 NA non-coding downstream 26693 1206710 ~ 1206976 (+)
G418691 NA non-coding downstream 152317 1332334 ~ 1332597 (+)
G418667 NA non-coding downstream 184997 1365014 ~ 1365559 (+)
G418694 NA non-coding downstream 195944 1375961 ~ 1376294 (+)
G418116 NA other upstream 304565 872670 ~ 875249 (+)
G418059 NA other upstream 615363 558092 ~ 564451 (+)
G417987 NA other upstream 951961 226703 ~ 227853 (+)
G418981 NA other downstream 912477 2092494 ~ 2093678 (+)
G420445 NA other downstream 3123319 4303336 ~ 4303832 (+)
CI01000304_05173869_05175309 NRARP, NRARP.L, NRARPA, NRARPB other downstream 3993206 5173426 ~ 5176791 (+)
G421162 NA other downstream 5061216 6241233 ~ 6242997 (+)
CI01000304_07352697_07354032 NA other downstream 6172632 7352621 ~ 7354396 (+)

Expression


Co-expression Network