G434485


Basic Information

Item Value
gene id G434485
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000306
NCBI id null
chromosome length 11491657
location 6965762 ~ 6965987 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU498831
GGTAATCATACTCATGATATATTCATATTCATAGTTTCCACAAAAATATTAAGCAGCACAACAGTTTTTAAATAATAAGAAATGTTTCTTGAGCAGCAAATCAGCATATTAGAATGATTTCTGAAGGATCATGTGACACTGAAGGCTGGAGTAATGATGCTGAAAATTCTCCTTTGCCATCACAGGAATAAATTGCATTCAAAAATATATTAAAATAGAAAACAGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU498831 True 226 lncRNA 0.31 1 6965762 6965987

Neighbor

gene id symbol gene type direction distance location
CI01000306_06815523_06829337 NA coding downstream 136246 6815441 ~ 6829516 (-)
CI01000306_06780961_06789374 NA coding downstream 176168 6780773 ~ 6789594 (-)
CI01000306_06776313_06778496 NA coding downstream 187066 6776114 ~ 6778815 (-)
CI01000306_06741870_06743844 NA coding downstream 221820 6741859 ~ 6743942 (-)
CI01000306_06414819_06416263 NA coding downstream 549080 6414541 ~ 6416682 (-)
CI01000306_06998286_07073243 PCDH17 coding upstream 32299 6998286 ~ 7073243 (-)
CI01000306_07331303_07340271 NA coding upstream 364965 7330952 ~ 7341271 (-)
CI01000306_07561305_07566290 LIMS1 coding upstream 594564 7560551 ~ 7566933 (-)
CI01000306_07680537_07684881 NXPH2B coding upstream 713881 7679868 ~ 7685987 (-)
CI01000306_07687805_07693178 NA coding upstream 721619 7687606 ~ 7693178 (-)
G434343 NA non-coding downstream 95736 6869809 ~ 6870026 (-)
G434325 NA non-coding downstream 115624 6849478 ~ 6850138 (-)
G434273 NA non-coding downstream 182811 6782669 ~ 6782951 (-)
G434098 NA non-coding downstream 491229 6467705 ~ 6474533 (-)
G434487 NA non-coding upstream 2458 6968445 ~ 6968662 (-)
G434506 NA non-coding upstream 114137 7080124 ~ 7080333 (-)
G434517 NA non-coding upstream 127096 7093083 ~ 7093304 (-)
G434519 NA non-coding upstream 127681 7093668 ~ 7093948 (-)
G434533 NA non-coding upstream 142489 7108476 ~ 7108677 (-)
G434338 NA other downstream 98826 6866656 ~ 6866936 (-)
G434086 NA other downstream 513511 6437406 ~ 6452251 (-)
G434016 NA other downstream 604119 6355180 ~ 6361643 (-)
G433985 NA other downstream 768552 6196107 ~ 6197210 (-)
G433670 NA other downstream 924479 6041014 ~ 6041283 (-)
G436446 NA other upstream 2690292 9656279 ~ 9671776 (-)
G436626 NA other upstream 2869038 9835025 ~ 9836323 (-)
G436643 NA other upstream 3056161 10022148 ~ 10025375 (-)

Expression


Co-expression Network