XLOC_012999 (si:ch211-132b12.4)


Basic Information

Item Value
gene id XLOC_012999
gene name si:ch211-132b12.4
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007129.7
NCBI id CM002902.2
chromosome length 51023478
location 40609153 ~ 40613189 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00025870
TGGAAGCGAAGAAATTAACCCAATTCAAGGAGAAATAGAGGAGCAATGGTTCAGAGGAAGCAAAGCAGAGTTTCTTCTGGCTGTGGCAGGAAATGTGGTTGGAGTGGGCAACGTGTGGAGGTTTTCCTTACCTCTGCTACAGGAATGGAGGATGGGCGTTCCTGATACCCTATCTGATGTTTGTGGTGACCTGTGGGGTTCCTCTGTTCCTGCTGGAGACAGCTATGGGACAGTTTACACAGCAAGGGGCCATTACATGCTGGCATCATCTCTGTCCACTAGCTGGGCGTATTGGATATGCAGGACAGCTAAAAGTGGTGTACGGCTGTATGTATTACATCATCATTCTGGCCTGGGCACTTTTCTACCTCATCTACTGCTTCAGCTCACAACTGCCATGGGCCAGCTGTGACAACATCTGGAACACAG

Function

symbol description
si:ch211-132b12.4 Predicted to enable gamma-aminobutyric acid:sodium symporter activity. Predicted to be involved in sodium ion transmembrane transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in neuron projection. Predicted to be integral component of plasma membrane.

GO:

id name namespace
GO:0006810 transport biological_process
GO:0035725 sodium ion transmembrane transport biological_process
GO:0043005 neuron projection cellular_component
GO:0005886 plasma membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0042165 neurotransmitter binding molecular_function
GO:0015293 symporter activity molecular_function
GO:0005328 neurotransmitter molecular_function
GO:0005332 gamma-aminobutyric acid molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050419-207 Predicted to enable gamma-aminobutyric acid:sodium symporter activity. Predicted to be involved in sodium ion transmembrane transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in neuron projection. Predicted to be integral component of plasma membrane.

Ensembl:

ensembl_id ENSDARG00000092930

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00025870 True 429 mRNA 0.49 3 40609153 40613189

Neighbor

gene id symbol gene type direction distance location
XLOC_012998 si:ch211-132b12.3 coding upstream 4790 40584288 ~ 40604363 (+)
XLOC_012997 si:ch211-132b12.2 coding upstream 26049 40572294 ~ 40583104 (+)
XLOC_012996 si:ch211-132b12.1 coding upstream 43377 40552620 ~ 40565776 (+)
XLOC_012995 vwa7 coding upstream 68450 40525408 ~ 40540703 (+)
XLOC_012994 NA coding upstream 88525 40518736 ~ 40520628 (+)
XLOC_013000 zgc:158427 coding downstream 4528 40617717 ~ 40638096 (+)
XLOC_013001 si:ch211-132b12.6 coding downstream 30471 40643660 ~ 40660847 (+)
XLOC_013002 NA coding downstream 54878 40668067 ~ 40669736 (+)
XLOC_013003 NA coding downstream 147452 40760641 ~ 40763051 (+)
XLOC_013004 NA coding downstream 288709 40901898 ~ 40902607 (+)
XLOC_012992 BX323575.2 non-coding upstream 142249 40466790 ~ 40466904 (+)
XLOC_012988 BX005280.1 non-coding upstream 585265 40023772 ~ 40023888 (+)
XLOC_012986 FO905036.1 non-coding upstream 872650 39736389 ~ 39736503 (+)
XLOC_012984 NA non-coding upstream 977128 39621465 ~ 39632025 (+)
XLOC_013006 NA non-coding downstream 575550 41188739 ~ 41227202 (+)
XLOC_013015 CU326349.3 non-coding downstream 1044298 41657487 ~ 41659824 (+)

Expression


Co-expression Network