CI01000340_02930635_02933799 (LSM2)


Basic Information

Item Value
gene id CI01000340_02930635_02933799
gene name LSM2
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000340
NCBI id null
chromosome length 19571558
location 2930635 ~ 2933935 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000340_02930635_02933799.mRNA
CTCTTCTACTCGTTCTTCAAGTCCTTGGTCGGCAAAGATGTTGTGGTGGAGCTCAAGAATGACTTGAGCATATGTGGAACATTGCACTCAGTTGATCAGTATTTGAACATCAAACTGACAGATATCAGTGTCACTGATCCAGAGAAATATCCGCATATGGAGAAATTCGTGAATGAGGGCTTCGACATGGAGGAGTGTTGCTCTGAGGTGCACCAAAGCAAAATGGACGAGCACATTCGTAAAGGTTATGCTCTAAACTCTATACTCAACGAGCTGTTTGAAGAAAAGATTTCTACTCAGAAGAAAAATCACTGGATACTTGGACCTGAGGACCTCAATGATACTCTTGTTCATGATTTTGAGATTGAAGAAGCAGCATGAGCTTTGCATCAGTGCCTGCATGGTTGTGCATTTACCTTTGAACCAAAGTTGCAGGTGAAAGTGCAGTTTTTAAAAATGACTTCAACTAATA

Function

symbol description
lsm2 Enables small GTPase binding activity. Involved in mRNA splicing, via spliceosome. Acts upstream of or within mRNA catabolic process and spliceosomal tri-snRNP complex assembly. Located in cytoplasm and nucleoplasm. Part of Lsm2-8 complex; U4/U6 x U5 tri-snRNP complex; and spliceosomal complex.

GO:

id name namespace
GO:0005737 cytoplasm cellular_component

KEGG:

id description
K12621 LSM2; U6 snRNA-associated Sm-like protein LSm2

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000340_02930635_02933799.mRNA False 472 mRNA 0.41 6 2930635 2933890

Neighbor

gene id symbol gene type direction distance location
CI01000340_02911658_02928746 INPP5D coding upstream 1291 2910973 ~ 2929344 (+)
CI01000340_02905987_02907006 GPR17 coding upstream 23561 2905128 ~ 2907074 (+)
CI01000340_02870871_02899752 NA coding upstream 30624 2870871 ~ 2900011 (+)
CI01000340_02846209_02868305 SAP130A coding upstream 61776 2846209 ~ 2868859 (+)
CI01000340_02817499_02825652 AMOTL2A, AMOTL2 coding upstream 104888 2817294 ~ 2825747 (+)
CI01000340_03053157_03201683 LPP coding downstream 119267 3053157 ~ 3201683 (+)
CI01000340_03242647_03264271 NA coding downstream 308757 3242647 ~ 3264850 (+)
CI01000340_03291151_03315214 NA coding downstream 356757 3290647 ~ 3315757 (+)
CI01000340_03320562_03329314 TP63 coding downstream 386579 3320469 ~ 3329682 (+)
CI01000340_03370316_03378878 NA coding downstream 436385 3370275 ~ 3379000 (+)
G486927 NA non-coding upstream 20093 2910261 ~ 2910542 (+)
G486913 NA non-coding upstream 34804 2841712 ~ 2895831 (+)
G486904 NA non-coding upstream 114458 2815960 ~ 2816177 (+)
G486899 NA non-coding upstream 119132 2811275 ~ 2811503 (+)
G486891 NA non-coding upstream 136079 2793806 ~ 2794556 (+)
G486858 NA non-coding downstream 30405 2964295 ~ 2964607 (+)
G486929 NA non-coding downstream 46696 2980586 ~ 2980904 (+)
G486948 NA non-coding downstream 287696 3221586 ~ 3221789 (+)
G486965 NA non-coding downstream 322204 3256094 ~ 3256816 (+)
G486972 NA non-coding downstream 343023 3276913 ~ 3277114 (+)
CI01000340_00312480_00313262 NA other upstream 2617390 312212 ~ 313534 (+)
G485427 NA other upstream 2763001 163286 ~ 167634 (+)
G485373 NA other upstream 2816866 106885 ~ 113769 (+)
G487133 NA other downstream 1040025 3973915 ~ 3982545 (+)
CI01000340_04399692_04401164 NA other downstream 1465529 4399419 ~ 4401496 (+)
CI01000340_04660938_04668996 NA other downstream 1730419 4659584 ~ 4669322 (+)
G489634 NA other downstream 3760331 6694221 ~ 6700788 (+)
G490645 NA other downstream 6104922 9038812 ~ 9043101 (+)
CI01000340_02930635_02933799 LSM2 other upstream 904 2930635 ~ 2933935 (+)

Expression


Co-expression Network