G520257


Basic Information

Item Value
gene id G520257
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000364
NCBI id null
chromosome length 520240
location 462019 ~ 462225 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU596855
ATGGAAGAAGGTGGTCAAGGTAAGAAACATGCAGGCTGCCAGCTTTCCATCAATTTTTTGCATAAATTGCTATAATTTTTAACAGTTCATGTTAAGTTTTGGTGTTCATTTTGGTAGCCTAGGCTAAATAGTTTACCAATTTACATAATGTTCTTGAAAACAATTATACCGAGCAGCAGCCCCTATATTTATGATTAACAATCAAAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU596855 True 207 lncRNA 0.33 1 462019 462225

Neighbor

gene id symbol gene type direction distance location
CI01000364_00458726_00460323 NA coding upstream 390 458726 ~ 461629 (+)
CI01000364_00400175_00427556 NA coding upstream 34443 399374 ~ 427576 (+)
CI01000364_00382475_00385399 NA coding upstream 75902 382475 ~ 386117 (+)
CI01000364_00294611_00295771 NA coding upstream 166069 294401 ~ 295950 (+)
CI01000364_00287825_00289294 NA coding upstream 170947 287047 ~ 291072 (+)
CI01000364_00471523_00472629 NA coding downstream 9298 471523 ~ 472821 (+)
CI01000364_00512592_00513897 NA coding downstream 49606 511831 ~ 514181 (+)
G520252 NA non-coding upstream 4958 456784 ~ 457061 (+)
G520244 NA non-coding upstream 15242 446461 ~ 446777 (+)
G520222 NA non-coding upstream 36311 425438 ~ 425708 (+)
G520208 NA non-coding upstream 85050 376701 ~ 376969 (+)
G520258 NA non-coding downstream 347 462572 ~ 463344 (+)
G520260 NA non-coding downstream 1520 463745 ~ 464082 (+)
G520013 NA other upstream 124912 309368 ~ 337107 (+)
G520009 NA other upstream 137788 241321 ~ 324231 (+)
G520012 NA other upstream 207013 250300 ~ 255006 (+)
CI01000364_00151094_00203772 NA other upstream 276976 150818 ~ 203857 (+)
G520007 NA other upstream 416173 44426 ~ 45846 (+)

Expression


Co-expression Network