XLOC_015457 (agtr1a)



Basic Information


Item Value
gene id XLOC_015457
gene name agtr1a
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information


Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 24931677 ~ 24932753 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence


>TCONS_00030912
ATGGACAACGTCACTTCCGACTCCAACACGGGACTTGCCCTCGCCTGTAACATGACAGGACACCACAGTTTCATCTTCACCTTCATCCCAGTTGTCTACAGCTTCAACTTCATCATCGGACTCATAGGCAACAGTCTGGTAGTCGCCGTCATCTACTTCTGCTTAAAACTGAAGACAGTAGCCAACATATTTGTCTTCAATCTAGCCGTTTCAGACCTTACATTCCTCCTCACCCTTCCCATCTGGGCCATTTCCACTGCAACAGGCTACCATTGGCTTTTCGGAGACCTCCTATGTAAAACAATAGCTGGTATGGCTCTCCTAAATCTATATACTAGTATTTTTCTTCTCACTGCTCTCAGCGTTGACAGATATTTGGCTATCGTTCATCCTGTCCAGTCTAGACGCTGCCGTACGGTGATCTATGCCCGGGTAACATGCGTTCTAGTTTGGGTGGTATCATTTGGCCTAAGCTTGCCCACAGCCATCATCCGTGGGACCCATTTCATCCAGGACAACAATGTTACCGTATGCGCCATTCACCACAAAGAAGACATTCGTAATGTCCTTGCAGCTCTCAGTCTGATGAAGAGCGTTTTTGGCTTTCTTCTGCCTATCACCGTCATCCTCACGTGCTACTGCCTAATTGGTCGGGCTCTGCCTAAAGCAAGGGACATTCAGAGAAATGCCAGGTCAAACGGGGATGAGGTCTTGAACATGTTGGCTGCTGCCGCCCTGTCCTTTTTCCTTTGCTGGGCTCCCCATCAGATCTTCAACTTCATGGAGATGCTTCTCCTGCTGAAAGTCATCACTAGCTGTGACGTTGTGGACATCATTGATACTGGGATGCCATTCACCATTTGCATTGCCTTTTTCAACAGCTGCATGAATCCAATATTGTACAGTTTTGTTGGAAAGAACTTCCGGAGGAACTTGTTGAAGCTCTTAAGGTGCTCCTCGACGTCCGTGGCCTCTCATCCAGCCCTCAGCACTAAGATGAGCTCACTTTCATATCGAACTTCAGAGTTATCGCACCTCTCTGTCATTAAAACCCCTTCACTCCCTCGGGCCACATGA

Function


symbol description
agtr1a Predicted to enable angiotensin type I receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway; inflammatory response; and positive regulation of cytosolic calcium ion concentration. Predicted to act upstream of or within regulation of vasoconstriction and signal transduction. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in plasma membrane. Human ortholog(s) of this gene implicated in several diseases, including Alzheimer's disease; COVID-19; artery disease (multiple); chronic kidney disease; and sarcoidosis. Orthologous to human AGTR1 (angiotensin II receptor type 1).

GO:

id name namespace
GO:0007186 G protein-coupled receptor signaling pathway biological_process
GO:0019229 regulation of vasoconstriction biological_process
GO:0007204 positive regulation of cytosolic calcium ion concentration biological_process
GO:0006954 inflammatory response biological_process
GO:0007165 signal transduction biological_process
GO:0005886 plasma membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0004930 G protein-coupled receptor activity molecular_function
GO:0004945 angiotensin type II receptor activity molecular_function
GO:0001596 angiotensin type I receptor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-070912-546 Predicted to enable angiotensin type I receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway; inflammatory response; and positive regulation of cytosolic calcium ion concentration. Predicted to act upstream of or within regulation of vasoconstriction and signal transduction. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in plasma membrane. Human ortholog(s) of this gene implicated in several diseases, including Alzheimer's disease; COVID-19; artery disease (multiple); chronic kidney disease; and sarcoidosis. Orthologous to human AGTR1 (angiotensin II receptor type 1).

Ensembl:

ensembl_id ENSDARG00000018616

RNA


RNA id representative length rna type GC content exon number start site end site
TCONS_00030912 True 1077 mRNA 0.48 1 24931677 24932753

Neighbor


gene id symbol gene type direction distance location
XLOC_015456 NA coding upstream 3923 24912293 ~ 24927754 (+)
XLOC_015455 NA coding upstream 25062 24903666 ~ 24906615 (+)
XLOC_015454 si:dkey-149i17.7 coding upstream 44925 24885987 ~ 24886752 (+)
XLOC_015453 rab3aa coding upstream 52864 24867534 ~ 24878813 (+)
XLOC_015452 pde4ca coding upstream 65028 24781026 ~ 24866649 (+)
XLOC_015458 gyg1a coding downstream 4013 24936766 ~ 24944819 (+)
XLOC_015459 stag1a coding downstream 86634 25019387 ~ 25108587 (+)
XLOC_015460 msl2a coding downstream 191745 25124498 ~ 25129409 (+)
XLOC_015461 NA coding downstream 197770 25130523 ~ 25137789 (+)
XLOC_015462 ppp2r3a coding downstream 265895 25198648 ~ 25291181 (+)
XLOC_015449 NA non-coding upstream 210890 24716314 ~ 24720787 (+)
XLOC_015446 NA non-coding upstream 319609 24603292 ~ 24612068 (+)
XLOC_015443 NA non-coding upstream 433836 24484273 ~ 24497841 (+)
XLOC_015468 CR392012.1 non-coding downstream 1101422 26034175 ~ 26039606 (+)
XLOC_015470 NA non-coding downstream 1233825 26166578 ~ 26167419 (+)
XLOC_015473 CR788230.1 non-coding downstream 1353712 26286465 ~ 26287505 (+)
XLOC_015478 NA non-coding downstream 1580855 26513608 ~ 26519549 (+)

Expression



Co-expression Network