Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

model fish

XLOC_002167

Basic Information

Item	Value
gene id	XLOC_002167
gene name	NA
gene type	non-coding
species	zebrafish (Danio rerio)
category of species	model fish

Chromosome Information

Item	Value
chromosome id	NC_007121.7
NCBI id	CM002894.2
chromosome length	45420867
location	26628793 ~ 26629282 (+)
genome version	GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00005715
TGACACAATTTCCTTTTTTTCCAGACTGGCCTTTTTATGAAGTAAAACTGGTTCTTCTCATCCTCCGTGAAGACGGAAACAAAACACATGATTATGATGCTAAAGAGGTTGCACACCAGTTGCTGACACAAGCATTAGCAGAGTTGGAATTGTGGCCCACATACATATATTTGAACAGTGTTCGAGTGTTTCCTAAAGGAGGCTCTCATAGTGGAAACCCAGAGAAGA

Function

GO: NA

KEGG:

id	description
ko03230	Viral genome structure
ko05164	Influenza A
ko03200	Viral proteins

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TCONS_00005715	True	228	lncRNA	0.41	4	26628793	26629282

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
XLOC_002166	fhl1b	coding	upstream	7604	26597990 ~ 26621189 (+)
XLOC_002165	slc9a6b	coding	upstream	30993	26571174 ~ 26597800 (+)
XLOC_002163	synj1	coding	upstream	59443	26515946 ~ 26569350 (+)
XLOC_002164	NA	coding	upstream	64272	26564221 ~ 26564521 (+)
XLOC_002162	BX530069.2	coding	upstream	322450	26306229 ~ 26306343 (+)
XLOC_002168	adgrg4b	coding	downstream	5190	26634472 ~ 26637493 (+)
XLOC_002169	adgrg4b	coding	downstream	16671	26645953 ~ 26652593 (+)
XLOC_002170	htatsf1	coding	downstream	23577	26652859 ~ 26667243 (+)
XLOC_002171	si:ch73-52f15.5	coding	downstream	38193	26667475 ~ 26677986 (+)
XLOC_002172	tmtops3b	coding	downstream	59980	26689262 ~ 26692647 (+)
XLOC_002161	NA	non-coding	upstream	355645	26269060 ~ 26273148 (+)
XLOC_002158	BX530083.1	non-coding	upstream	664394	25964284 ~ 25964399 (+)
XLOC_002156	NA	non-coding	upstream	863222	25762203 ~ 25765571 (+)
XLOC_002174	CR545465.1	non-coding	downstream	137103	26766385 ~ 26771677 (+)
XLOC_002175	NA	non-coding	downstream	157087	26786369 ~ 26786785 (+)
XLOC_002181	NA	non-coding	downstream	253420	26882702 ~ 26883139 (+)
XLOC_002190	NA	non-coding	downstream	432479	27061761 ~ 27064405 (+)
XLOC_002193	NA	non-coding	downstream	539844	27169126 ~ 27198982 (+)

Expression

Co-expression Network