XLOC_030160 (mir100-2)


Basic Information

Item Value
gene id XLOC_030160
gene name mir100-2
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007116.7
NCBI id CM002889.2
chromosome length 72500376
location 29990147 ~ 29990221 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00058974
AGCTGCCACAAACCCGTAGATCCGAACTTGTGGTGTCTCTGTGCACAAGCTCGTGTCTATAGGTATGTGTCTGCG

Function

symbol description
mir100-2 Acts upstream of or within response to vitamin D.

GO:

id name namespace
GO:0033280 response to vitamin D biological_process

KEGG: NA

ZFIN:

id description
ZDB-MIRNAG-090929-109 Acts upstream of or within response to vitamin D.

Ensembl:

ensembl_id ENSDARG00000081453

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00058974 True 75 miRNA 0.52 1 29990147 29990221

Neighbor

gene id symbol gene type direction distance location
XLOC_030159 NA coding upstream 1716 29902153 ~ 29988431 (+)
XLOC_030158 ubash3ba coding upstream 93379 29851433 ~ 29896768 (+)
XLOC_030157 f11r.1 coding upstream 141375 29831195 ~ 29848772 (+)
XLOC_030156 f11r.2 coding upstream 164301 29820266 ~ 29825846 (+)
XLOC_030155 usf1l coding upstream 172299 29803380 ~ 29817848 (+)
XLOC_030161 dre-let-7a-4 coding downstream 231 29990452 ~ 29990544 (+)
XLOC_030162 dre-mir-125b-2 coding downstream 8541 29998762 ~ 29998847 (+)
XLOC_030163 timm8b coding downstream 99494 30089715 ~ 30090506 (+)
XLOC_030164 BX897688.1 coding downstream 176235 30166456 ~ 30166572 (+)
XLOC_030165 adamts15a coding downstream 188789 30179010 ~ 30209068 (+)
XLOC_030153 NA non-coding upstream 197523 29784172 ~ 29792624 (+)
XLOC_030150 NA non-coding upstream 424322 29560059 ~ 29565825 (+)
XLOC_030149 NA non-coding upstream 746987 29241794 ~ 29243160 (+)
XLOC_030148 CT956057.3 non-coding upstream 775501 29214530 ~ 29214646 (+)
XLOC_030174 BX276103.2 non-coding downstream 732908 30723129 ~ 30727648 (+)
XLOC_030177 NA non-coding downstream 790209 30780430 ~ 30974079 (+)

Expression


Co-expression Network