XLOC_003119 (vgll4b)


Basic Information

Item Value
gene id XLOC_003119
gene name vgll4b
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 769623 ~ 772459 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00006162
GGCCGAATCCAGAACTCAATCCCGGATCCGCGCGCCGCGCTCCGGCTTCTGCTCCGCCGGACTTCGCTCTCCGGGCTGGAGACCCTTCACGGGTCTGGTCCAGCATGGAAACGCCTTTGGATGTTTTGTCAAGAGCAGCATCTTTAGTGCATCAAGATGACGAGAAGCGTGAG

Function

symbol description
vgll4b Predicted to enable transcription coactivator binding activity. Acts upstream of or within hippo signaling. Is expressed in several structures, including digestive system; epidermis; forerunner cell group; nervous system; and swim bladder. Orthologous to human VGLL4 (vestigial like family member 4).

GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0035329 hippo signaling biological_process
GO:0045892 negative regulation of transcription, DNA-templated biological_process
GO:0001223 transcription coactivator binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040426-2445 Predicted to enable transcription coactivator binding activity. Acts upstream of or within hippo signaling. Is expressed in several structures, including digestive system; epidermis; forerunner cell group; nervous system; and swim bladder. Orthologous to human VGLL4 (vestigial like family member 4).

Ensembl:

ensembl_id ENSDARG00000103730

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00006162 True 173 mRNA 0.60 2 769623 772459

Neighbor

gene id symbol gene type direction distance location
XLOC_003118 FQ311892.1 coding upstream 38700 730807 ~ 730923 (+)
XLOC_003117 timp4.3 coding upstream 50875 714386 ~ 718748 (+)
XLOC_003116 timp4.2 coding upstream 58591 705727 ~ 711032 (+)
XLOC_003115 timp4.1 coding upstream 68318 691734 ~ 701305 (+)
XLOC_003114 mkrn2os.2 coding upstream 180495 583142 ~ 589128 (+)
XLOC_003120 tamm41 coding downstream 7295 779754 ~ 790304 (+)
XLOC_003121 vgll4b coding downstream 34694 807153 ~ 815216 (+)
XLOC_003122 ppp1r3db coding downstream 637163 1409622 ~ 1412356 (+)
XLOC_003123 acot8 coding downstream 740112 1512571 ~ 1520946 (+)
XLOC_003124 srsf6b coding downstream 749668 1522127 ~ 1530865 (+)
XLOC_003250 BX324177.11 misc downstream 10573344 11345803 ~ 11346099 (+)
XLOC_003255 BX324177.14 misc downstream 10600427 11372886 ~ 11373182 (+)
XLOC_003257 BX324177.13 misc downstream 10613903 11386362 ~ 11386658 (+)
XLOC_003260 BX324177.2 misc downstream 10645574 11418033 ~ 11418323 (+)
XLOC_003262 BX324177.15 misc downstream 10656934 11429393 ~ 11429689 (+)
XLOC_003112 NA non-coding upstream 225429 543348 ~ 544194 (+)
XLOC_003109 NA non-coding upstream 264794 474380 ~ 504829 (+)
XLOC_003110 NA non-coding upstream 275090 489935 ~ 494533 (+)
XLOC_003107 CR855375.1 non-coding upstream 398183 371322 ~ 371440 (+)
XLOC_003126 AL935272.1 non-coding downstream 773658 1546117 ~ 1546231 (+)
XLOC_003132 NA non-coding downstream 1163225 1935684 ~ 1997410 (+)
XLOC_003133 NA non-coding downstream 1179172 1951631 ~ 1952594 (+)
XLOC_003138 mir196c non-coding downstream 1418162 2190621 ~ 2190730 (+)
XLOC_003139 NA non-coding downstream 1426071 2198530 ~ 2205798 (+)

Expression


Co-expression Network