Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

model fish

XLOC_031250

Basic Information

Item	Value
gene id	XLOC_031250
gene name	NA
gene type	non-coding
species	zebrafish (Danio rerio)
category of species	model fish

Chromosome Information

Item	Value
chromosome id	NC_007116.7
NCBI id	CM002889.2
chromosome length	72500376
location	37592276 ~ 37603735 (-)
genome version	GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00061540
CCAGCAAGAACACAGTACTAAACATATATAAAACTGTAGTCTCTGCATCTCCACCATTACAACTTGCTGAAGTGCAGCAATGTGGCTGACAACATAGGTCACATGGCAATGCACAGATGTAACAATCCTTCAGGCCAAAGACAAAATGGCTGCCAGACATGTCCGTGTGCTTCTCATCTCTGCAGGGGTGATCATAGTGACTGGCCTGATAACATATTGG

Function

GO: NA

KEGG:

id	description
ko03230	Viral genome structure
ko05164	Influenza A
ko03200	Viral proteins

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TCONS_00061540	True	220	lncRNA	0.45	3	37592276	37603735

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
XLOC_031249	NA	coding	downstream	109256	37480447 ~ 37483020 (-)
XLOC_031248	wdr44	coding	downstream	251232	37316683 ~ 37341044 (-)
XLOC_031247	NA	coding	downstream	319965	37266944 ~ 37272311 (-)
XLOC_031246	lrch2	coding	downstream	327781	37132016 ~ 37264495 (-)
XLOC_031245	il13ra2	coding	downstream	474498	37101393 ~ 37117778 (-)
XLOC_031251	NA	coding	upstream	104967	37708702 ~ 37711850 (-)
XLOC_031252	AL935065.1	coding	upstream	214135	37817870 ~ 37820878 (-)
XLOC_031253	arhgap35b	coding	upstream	260970	37864705 ~ 37881345 (-)
XLOC_031254	si:ch211-139a5.9	coding	upstream	280287	37884022 ~ 37886077 (-)
XLOC_031255	tmprss13b	coding	upstream	284360	37888095 ~ 37900395 (-)
XLOC_031242	BX927323.1	non-coding	downstream	648301	36934568 ~ 36943975 (-)
XLOC_031240	NA	non-coding	downstream	684897	36903146 ~ 36907379 (-)
XLOC_031238	NA	non-coding	downstream	763203	36821874 ~ 36829073 (-)
XLOC_031259	BX640520.1	non-coding	upstream	431602	38035337 ~ 38038217 (-)
XLOC_031269	NA	non-coding	upstream	646309	38250044 ~ 38255744 (-)
XLOC_031276	NA	non-coding	upstream	1011133	38614868 ~ 38633719 (-)
XLOC_031277	NA	non-coding	upstream	1017222	38620957 ~ 38622971 (-)

Expression

Co-expression Network