XLOC_031957 (pimr4)


Basic Information

Item Value
gene id XLOC_031957
gene name pimr4
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007117.7
NCBI id CM002890.2
chromosome length 60270059
location 17181157 ~ 17182473 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00062543
aggttggaggagattgtccatgtcccacatgggtgaagaaagaggagaagatacacgggactgcaccactgagcttcctggttttttggctcctctgccttcacatttggctaattctgcatccacagaccagaggaacagcaagaggaaaaggcagagcagcagccagcaaacactgtccacctcgtccagcagaccagccaaacgctctcgcagagacttgtacctgaagggcccgttgctgggacgaggtggattcggctctgtgtttgctgggatgcgcaggtctgatggactgccagtggccatcaagtacgtgtcgaaggaccggacccccgagcgactgaaagttgatggtcagggtcggctgccgctggaggtggcattgatgacccgtgtcacgtcagctcctgcctgccccagtgtcctgcagctgctggactggtttgaccgtcccagacgctacatcctgatcctggagcgaccggatccttgccaagatctccagagcttctgtgaggagaacggctgtctggatgagcgtctggccaagaaagtgctggtgcagctgatcgaggccctaaaacactgcgagagccgcggcgtcctgcaccgggacgtcaaaccagaaaacctgctgatctccacagagtcccaggacatcaagctgctggacttcggctgtggagatctgctgaagcgatcggcctacaaatactttgcaggcactcctgcatacgctcctcctga

Function

symbol description
pimr4 Predicted to enable protein serine/threonine kinase activity. Predicted to be involved in negative regulation of apoptotic process; protein autophosphorylation; and regulation of mitotic cell cycle. Predicted to act upstream of or within protein phosphorylation. Predicted to be active in cytoplasm.

GO: NA

KEGG: NA

Ensembl:

ensembl_id ENSDARG00000111303

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00062543 True 750 mRNA 0.57 6 17181157 17182473

Neighbor

gene id symbol gene type direction distance location
XLOC_031956 pimr5 coding upstream 66164 17113677 ~ 17114993 (+)
XLOC_031954 pimr16 coding upstream 126191 17053650 ~ 17054966 (+)
XLOC_031953 BX511311.5 coding upstream 130022 17051039 ~ 17051135 (+)
XLOC_031952 pimr8 coding upstream 197233 16982613 ~ 16983924 (+)
XLOC_031951 pimr13 coding upstream 229997 16949735 ~ 16951160 (+)
XLOC_031958 BX511311.8 coding downstream 22719 17205192 ~ 17205289 (+)
XLOC_031959 pimr11 coding downstream 25549 17208022 ~ 17209265 (+)
XLOC_031960 pimr15 coding downstream 85208 17267681 ~ 17268997 (+)
XLOC_031961 CABZ01041996.1 coding downstream 135084 17317557 ~ 17317653 (+)
XLOC_031962 BX470083.5 coding downstream 199012 17381485 ~ 17381582 (+)
XLOC_031948 NA non-coding upstream 371931 16799202 ~ 16809226 (+)
XLOC_031945 NA non-coding upstream 506473 16591985 ~ 16674684 (+)
XLOC_031946 NA non-coding upstream 512011 16667458 ~ 16669146 (+)
XLOC_031941 NA non-coding upstream 783632 16394629 ~ 16397525 (+)
XLOC_031963 NA non-coding downstream 349545 17532018 ~ 17533025 (+)
XLOC_031964 CR391990.1 non-coding downstream 429571 17612044 ~ 17613202 (+)

Expression


Co-expression Network