G1516172


Basic Information

Item Value
gene id G1516172
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 10402459 ~ 10402750 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1735437
GTAACTCCTTCTGACTCCCTGTAACTCCATGTAACTCATTCTAACTCCCTGTAACTCCTTCTGACTCCCTGTAACTCCCTGTAACTCCTTCTGACTCCCTGTAACTCCTTCTGACTCCCTGTAACTCCCTGTAACTCCTTCTAACTCCCTGTAACTCCTTCTAACTCCTTCTAACTCCCTGTAACTCCTTCTGACTCCATGTAACTCCTTCTGACTCCCTGTAACTCCCTGTAACTCCTTCTGACTCCCTGTAACTCCTTCTGACTCCCTGTAACTCCTTCTGACTCCCTGC

Function

NR:

description
PREDICTED: IQ motif and SEC7 domain-containing protein 2-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1735437 True 292 lncRNA 0.48 1 10402459 10402750

Neighbor

gene id symbol gene type direction distance location
LOC118941089 LOC106574813 coding upstream 33881 10362570 ~ 10368578 (+)
LOC118941088 LOC106575836 coding upstream 253330 10146949 ~ 10149129 (+)
LOC110495585 LOC106574888 coding upstream 268331 10131530 ~ 10134128 (+)
LOC118941061 NA coding upstream 280649 10118660 ~ 10121810 (+)
LOC110495584 LOC106574807 coding upstream 509224 9887375 ~ 9893235 (+)
LOC118941090 LOC106575811 coding downstream 453619 10856369 ~ 10862119 (+)
LOC110527277 LOC106575822 coding downstream 541653 10944403 ~ 10956829 (+)
LOC118936256 LOC100194643 coding downstream 557994 10960744 ~ 10967479 (+)
LOC118941091 NA coding downstream 559035 10961785 ~ 10965666 (+)
LOC110527282 acadl coding downstream 571078 10973828 ~ 10979399 (+)
G1516169 NA non-coding upstream 4913 10397282 ~ 10397546 (+)
G1516154 NA non-coding upstream 49797 10352358 ~ 10352662 (+)
G1516145 NA non-coding upstream 65437 10336778 ~ 10337022 (+)
G1516136 NA non-coding upstream 76594 10310107 ~ 10327138 (+)
G1516131 NA non-coding upstream 101434 10300579 ~ 10301025 (+)
G1516174 NA non-coding downstream 7784 10410534 ~ 10410752 (+)
G1516178 NA non-coding downstream 11691 10414441 ~ 10414717 (+)
G1516179 LOC106569275 non-coding downstream 12007 10414757 ~ 10415193 (+)
G1516181 NA non-coding downstream 16707 10419457 ~ 10419810 (+)
G1516187 NA non-coding downstream 22060 10424810 ~ 10425138 (+)
G1515853 NA other upstream 230503 10170102 ~ 10171956 (+)
G1515776 NA other upstream 427153 9974528 ~ 9975306 (+)
G1515005 cbs other upstream 1399333 9000398 ~ 9003126 (+)
LOC110495395 LOC106574852 other upstream 1722249 8677497 ~ 8682383 (+)
G1516637 NA other downstream 614015 11016765 ~ 11017089 (+)
LOC118941092 LOC106575823 other downstream 683335 10978682 ~ 11092554 (+)
G1517015 NA other downstream 1230317 11633067 ~ 11634979 (+)
G1517019 NA other downstream 1240039 11642789 ~ 11643758 (+)
G1517150 NA other downstream 1537312 11940062 ~ 11941897 (+)

Expression


Co-expression Network