G1521065 (tubgcp3)


Basic Information

Item Value
gene id G1521065
gene name tubgcp3
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048582.1
NCBI id CM023236.2
chromosome length 74657750
location 16600226 ~ 16600714 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1741449
CACAACTCTACCTTGGCAGAAGTCAACGAGGGCAGCCAGGGTTTTGAGGCGGACTTTCGGGTCGTAGGTCCAGACTAGGAGACGTCTGAGGGTCAGACTGCTCTCCACTCCCAGGTTCACTCCCTGGTCATCCTCCACCTGCTGTGAGTGCAGCACTGCCAGAAGTCTGTAGTACTCCTTCAGTTCCTGATGCAGGGAGGCACAGAAGCTCTGTCCCACCAGGCCAAAGGCTCGGTCCAGACTGCGCGAGTCAGTGTACTTCCTGATCTTGTTGTGGAGCCAGCCCAGCTCAGCCAATCGGCTACTGGTGTCCCTCAGAGACTTACAGAGCACCACCTAGGGACACACTGGAGAA

Function

symbol description
tubgcp3 Predicted to enable gamma-tubulin binding activity. Predicted to contribute to microtubule minus-end binding activity. Predicted to be involved in meiotic cell cycle; microtubule cytoskeleton organization; and mitotic cell cycle. Predicted to act upstream of or within microtubule cytoskeleton organization. Predicted to be located in cytoplasm and microtubule cytoskeleton. Predicted to be part of gamma-tubulin small complex. Predicted to be active in centrosome and equatorial microtubule organizing center. Is expressed in ciliary marginal zone; head; and optic cup. Orthologous to human TUBGCP3 (tubulin gamma complex associated protein 3).

NR:

description
gamma-tubulin complex component 3 homolog

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1741449 True 355 lncRNA 0.57 2 16600226 16600714

Neighbor

gene id symbol gene type direction distance location
LOC110495676 LOC106575553 coding upstream 104090 16486853 ~ 16496136 (+)
LOC110495675 LOC106575507 coding upstream 113922 16476472 ~ 16486304 (+)
LOC110495678 LOC106575507 coding upstream 126126 16471104 ~ 16474100 (+)
LOC110495674 LOC106575504 coding upstream 131773 16454118 ~ 16468453 (+)
LOC110495673 NA coding upstream 168873 16427597 ~ 16431410 (+)
LOC110495683 LOC106575518 coding downstream 12935 16613649 ~ 16685491 (+)
LOC110497065 LOC106574631 coding downstream 372369 16973083 ~ 16984148 (+)
LOC110495688 LOC106574622 coding downstream 387026 16987740 ~ 17001956 (+)
LOC110495691 LOC106574621 coding downstream 404315 17005029 ~ 17009539 (+)
LOC110495692 tm182 coding downstream 465163 17065877 ~ 17069278 (+)
G1521054 NA non-coding upstream 14023 16584149 ~ 16586203 (+)
G1521053 NA non-coding upstream 16275 16583665 ~ 16583951 (+)
G1521026 NA non-coding upstream 59885 16539828 ~ 16540341 (+)
G1521008 NA non-coding upstream 83872 16516106 ~ 16516354 (+)
G1520973 NA non-coding upstream 160833 16438959 ~ 16439393 (+)
G1521113 NA non-coding downstream 89780 16690494 ~ 16690857 (+)
G1521114 NA non-coding downstream 91760 16692474 ~ 16692701 (+)
G1521118 NA non-coding downstream 101789 16702503 ~ 16702709 (+)
G1521124 NA non-coding downstream 118514 16719228 ~ 16719438 (+)
G1520748 NA other upstream 661408 15938230 ~ 15938818 (+)
G1520742 NA other upstream 677327 15919157 ~ 15922899 (+)
G1520649 NA other upstream 784221 15756493 ~ 15816005 (+)
LOC110527374 LOC106592210 other downstream 1023102 17623786 ~ 17631132 (+)
G1522415 LOC106575491 other downstream 1165505 17766219 ~ 17766694 (+)
G1522437 LOC106575479 other downstream 1238955 17839669 ~ 17844014 (+)
G1522438 NA other downstream 1255427 17856141 ~ 17860614 (+)
G1522684 NA other downstream 1778373 18379087 ~ 18380258 (+)

Expression


Co-expression Network