G1670229


Basic Information

Item Value
gene id G1670229
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048584.1
NCBI id CM023238.2
chromosome length 46616863
location 18196135 ~ 18202995 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1911000
acaaagaacagggccattctttcacctgacagctagccagccggagagacggggaacaggatagggaaacagtgcgcagcgggcgctgcagagccaccagagaagatggctagcagcccagagaagagttgacagtgaaacttacaatctggccaaggagcagagactgaactttggagacgacatcccgagtgccctgcgggtcgctaagaggaagcgctggaatagcattgaggagaagcgcatcaaccaggagaacaagctgcatgcatatctcaccaaacttatcctagcagagaaggaga

Function

NR:

description
STIP1 homology and U box-containing protein 1-like

GO: NA

KEGG:

id description

RNA

RNA id representative length rna type GC content exon number start site end site
TU1911000 True 305 lncRNA 0.54 2 18196135 18202995

Neighbor

gene id symbol gene type direction distance location
LOC118942046 NA coding upstream 353045 17838093 ~ 17843090 (+)
LOC118942045 NA coding upstream 580685 17607281 ~ 17615450 (+)
LOC118942044 NA coding upstream 590969 17600129 ~ 17605166 (+)
LOC118942043 NA coding upstream 608948 17580590 ~ 17587187 (+)
LOC118942042 LOC105021261 coding upstream 700394 17484324 ~ 17495741 (+)
LOC110499153 LOC106589263 coding downstream 891887 19094882 ~ 19201695 (+)
LOC110499151 LOC106589264 coding downstream 1004257 19207252 ~ 19242695 (+)
LOC110499149 LOC106589267 coding downstream 1092128 19295123 ~ 19303669 (+)
LOC110499145 LOC106589268 coding downstream 1108375 19311370 ~ 19350990 (+)
LOC118942048 NA coding downstream 1173244 19376239 ~ 19378591 (+)
G1670210 NA non-coding upstream 23424 18104943 ~ 18172711 (+)
G1670209 LOC105007702 non-coding upstream 63665 18051611 ~ 18132470 (+)
G1670216 NA non-coding upstream 87722 18100153 ~ 18108413 (+)
G1670215 NA non-coding upstream 106518 18083482 ~ 18089617 (+)
G1670208 NA non-coding upstream 145516 18050062 ~ 18050619 (+)
G1670238 LOC105021261 non-coding downstream 3798 18206793 ~ 18214411 (+)
G1670197 LOC106593034 non-coding downstream 133850 18336845 ~ 18362915 (+)
G1670248 NA non-coding downstream 158125 18361120 ~ 18364878 (+)
G1670185 NA non-coding downstream 166651 18369646 ~ 18391878 (+)
G1670201 NA non-coding downstream 168231 18371226 ~ 18742987 (+)
G1670125 LOC105007702 other upstream 416761 17717036 ~ 17812707 (+)
G1670126 NA other upstream 422433 17767481 ~ 17773702 (+)
G1670129 NA other upstream 435323 17752294 ~ 17760812 (+)
G1670091 NA other upstream 618873 17572831 ~ 17577262 (+)
G1671091 NA other downstream 2024800 20227795 ~ 20228168 (+)
G1672918 NA other downstream 2886408 21089403 ~ 21089830 (+)
G1672973 NA other downstream 2937530 21140525 ~ 21191078 (+)
G1673044 NA other downstream 3093377 21296372 ~ 21296854 (+)

Expression


Co-expression Network