XLOC_037629 (slc23a3)


Basic Information

Item Value
gene id XLOC_037629
gene name slc23a3
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007120.7
NCBI id CM002893.2
chromosome length 56459846
location 7394229 ~ 7394412 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00073890
CTTTCACTCTGGTATATCTACACTGCTGCAGAGCTGGATTGGATCACGTTTGCCATTGATTCAGGCTCCATCTTTGGACTTTCTGATCCCGGCCATG

Function

symbol description
slc23a3 Predicted to enable transmembrane transporter activity. Predicted to act upstream of or within transmembrane transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Orthologous to human SLC23A3 (solute carrier family 23 member 3).

GO:

id name namespace
GO:0055085 transmembrane transport biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0022857 transmembrane transporter activity molecular_function
GO:0005215 transporter activity molecular_function

KEGG:

id description
ko02000 Transporters

ZFIN:

id description
ZDB-GENE-070912-714 Predicted to enable transmembrane transporter activity. Predicted to act upstream of or within transmembrane transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Orthologous to human SLC23A3 (solute carrier family 23 member 3).

Ensembl:

ensembl_id ENSDARG00000088891

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00073890 True 97 mRNA 0.48 2 7394229 7394412

Neighbor

gene id symbol gene type direction distance location
XLOC_037628 slc23a3 coding downstream 3841 7390207 ~ 7390388 (-)
XLOC_037627 slc23a3 coding downstream 15663 7371962 ~ 7378566 (-)
XLOC_037626 BX942813.1 coding downstream 34745 7357819 ~ 7359484 (-)
XLOC_037625 mitd1 coding downstream 106854 7275185 ~ 7287375 (-)
XLOC_037624 si:ch211-121j5.4 coding downstream 136352 7240896 ~ 7257877 (-)
XLOC_037630 bin1a coding upstream 16386 7410798 ~ 7444753 (-)
XLOC_037631 NA coding upstream 104848 7499260 ~ 7505531 (-)
XLOC_037632 desma coding upstream 121452 7515864 ~ 7539326 (-)
XLOC_037633 dnajb2 coding upstream 227210 7621622 ~ 7655301 (-)
XLOC_037634 tuba8l3 coding upstream 268226 7662638 ~ 7673856 (-)
XLOC_037618 BX842683.1 non-coding downstream 676428 6717677 ~ 6717801 (-)
XLOC_037614 NA non-coding downstream 845433 6531549 ~ 6548796 (-)
XLOC_037613 FQ377643.1 non-coding downstream 984958 6409157 ~ 6409271 (-)
XLOC_037602 NA non-coding downstream 2526790 4866100 ~ 4867439 (-)
XLOC_037636 NA non-coding upstream 547357 7941769 ~ 7942597 (-)
XLOC_037637 NA non-coding upstream 765929 8160341 ~ 8163995 (-)
XLOC_037638 NA non-coding upstream 889743 8284155 ~ 8286208 (-)
XLOC_037644 BX537313.1 non-coding upstream 1614711 9009123 ~ 9024269 (-)

Expression


Co-expression Network