XLOC_037663


Basic Information

Item Value
gene id XLOC_037663
gene name NA
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007120.7
NCBI id CM002893.2
chromosome length 56459846
location 10368380 ~ 10370625 (-)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00074962
ggcgtgactcctttttcattgcccgggatttagcaggcagacgcagcttctgcaatggtcgacattaactgctcccagcagcggatctgattaacacgataccaaagtgattttgttacctgtggatcttcaaacttcacatccagagttgtgaggaatcagaggtgcatgcggctgcccacgggaaaaaattgccatcagcccaacacagtttggattatcataggactgtcagaggtttgccaaacctgtcaaatgcatgatggctcctgtttggacttaccgatgtcctcgacttcaagtatccatcaaaactgtatacatttaagatgtattagagactctttgtgggactggacattatgcatccaaaatcttcatcaaaatatgcaaatctcctcactgagttgccttggatgatttctcaataggatctggtattattaatgtttttatttatgtattgtgtacgtgtagccacattaatggcctattttgtagtcactattaaaaggaacattgattgatattgaatacatgttatggtctttaatccatcttcccattcttatttaattgttattgacaggaaagtctgtttatctgtgtttactagtgtatattgtgcttacaatatagaaacgccgatttattttctgaggttacagccagaagtcaattaaattcgttttaaatgacatatgcatggttaattttatttagatcattaagttcataatacttaattaaaatgagtacagtcaacatatagcaatgtataagtaagttaagttt

Function

GO:

id name namespace
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0016070 RNA metabolic process biological_process
GO:0048762 mesenchymal cell differentiation biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:0048863 stem cell differentiation biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:0010467 gene expression biological_process
GO:0010468 regulation of gene expression biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0060485 mesenchyme development biological_process
GO:0014033 neural crest cell differentiation biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0043170 macromolecule metabolic process biological_process
GO:0006807 nitrogen compound metabolic process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0005634 nucleus cellular_component
GO:0043227 membrane-bounded organelle cellular_component
GO:0043231 intracellular membrane-bounded organelle cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0097159 organic cyclic compound binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:1901363 heterocyclic compound binding molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00074962 True 795 lncRNA 0.37 3 10368380 10370625

Neighbor

gene id symbol gene type direction distance location
XLOC_037661 hnmt coding downstream 222500 10138196 ~ 10145880 (-)
XLOC_037660 spopla coding downstream 300275 10050890 ~ 10068105 (-)
XLOC_037659 ugt1a1 coding downstream 364598 9969987 ~ 10003782 (-)
XLOC_037658 prmt2 coding downstream 407440 9953063 ~ 9960940 (-)
XLOC_037657 fstl1b coding downstream 526231 9735493 ~ 9842149 (-)
XLOC_037664 tmbim1b coding upstream 387714 10758339 ~ 10769097 (-)
XLOC_037665 CABZ01053619.1 coding upstream 407602 10778227 ~ 10778615 (-)
XLOC_037666 si:ch1073-416j23.1 coding upstream 411062 10781687 ~ 10805231 (-)
XLOC_037667 BX000444.1 coding upstream 475293 10845918 ~ 10846549 (-)
XLOC_037668 chpfa coding upstream 875337 11245962 ~ 11263228 (-)
XLOC_037651 AL954142.4 non-coding downstream 997514 9355372 ~ 9370866 (-)
XLOC_037649 NA non-coding downstream 1079310 9286419 ~ 9289070 (-)
XLOC_037645 NA non-coding downstream 1317865 9026383 ~ 9050515 (-)
XLOC_037644 BX537313.1 non-coding downstream 1344111 9009123 ~ 9024269 (-)
XLOC_037638 NA non-coding downstream 2082172 8284155 ~ 8286208 (-)
XLOC_037671 NA non-coding upstream 1200687 11571312 ~ 11572354 (-)
XLOC_037673 NA non-coding upstream 1225362 11595987 ~ 11655031 (-)
XLOC_037675 NA non-coding upstream 1451754 11822379 ~ 11855305 (-)
XLOC_037677 NA non-coding upstream 1706218 12076843 ~ 12171785 (-)

Expression


Co-expression Network