G48079 (camk1g,LOC102780232,LOC102204221,LOC101478990,LOC103361639)


Basic Information

Item Value
gene id G48079
gene name camk1g,LOC102780232,LOC102204221,LOC101478990,LOC103361639
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053116.1
NCBI id CM020913.1
chromosome length 44101041
location 8690703 ~ 8700088 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU64209
CCTCCAGCCCCACCACATTGTCGTGTTTGATTCGTCTCAACACGGCGATCTCATTCTCCAGACTGAGGTCTCGTTTCTGTTTCTTCTTCACGCACTTCATGGCAAACATCTGTCCCGTCTTCTTCTCCTTCACCATGTACACCTCGGAGAACGCCCCCGATCCCAACTCCTCCATGAAGTCGAAAACCTCGTGGATGTTTTCAGTGACCTTCTTCCACACGTGGTCGCCCTCTTGACGACCCATGTCTGCAGGCGCGTCCACAGGGATTTCCAGAGACTCTGCGCTGTGGGAGCTCCGCTCTGACTCTCCTGCCAAAGGC

Function

symbol description
camk1g Predicted to enable calmodulin binding activity and calmodulin-dependent protein kinase activity. Predicted to be involved in peptidyl-serine phosphorylation. Predicted to be located in endomembrane system. Predicted to be part of calcium- and calmodulin-dependent protein kinase complex.

NR:

description
PREDICTED: calcium/calmodulin-dependent protein kinase type 1G-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU64209 True 320 lncRNA 0.55 4 8690703 8700088

Neighbor

gene id symbol gene type direction distance location
LOC120559286 NA coding upstream 36387 8645778 ~ 8654316 (+)
itih6 itih6 coding upstream 57878 8605863 ~ 8632825 (+)
LOC120559284 pfkfb1,LOC100700435,LOC101066702 coding upstream 84945 8562053 ~ 8605758 (+)
LOC120559288 NA coding upstream 120372 8569081 ~ 8570331 (+)
LOC120559290 NA coding upstream 129620 8558038 ~ 8561083 (+)
pfdn4 pfdn4 coding downstream 500664 9200752 ~ 9210559 (+)
LOC120558451 LOC100703402 coding downstream 534072 9234160 ~ 9236016 (+)
cd40 NA coding downstream 657884 9357972 ~ 9366078 (+)
zbtb48 LOC102780700 coding downstream 835319 9535407 ~ 9544237 (+)
syt6a syt6,LOC103150978,LOC106928401,LOC103467834 coding downstream 897538 9597626 ~ 9689330 (+)
G48075 NA non-coding upstream 13372 8674473 ~ 8677331 (+)
G48063 NA non-coding upstream 157902 8532596 ~ 8532801 (+)
G48039 NA non-coding upstream 242389 8448107 ~ 8448314 (+)
G48018 NA non-coding upstream 308974 8381491 ~ 8381729 (+)
G48017 NA non-coding upstream 309275 8381087 ~ 8381428 (+)
G48158 NA non-coding downstream 14231 8714319 ~ 8714568 (+)
G48160 NA non-coding downstream 15799 8715887 ~ 8716184 (+)
G48176 NA non-coding downstream 43546 8743634 ~ 8747729 (+)
G48205 NA non-coding downstream 126370 8826458 ~ 8826676 (+)
G48206 NA non-coding downstream 143821 8843909 ~ 8851173 (+)
G48077 NA other upstream 2739 8680282 ~ 8687964 (+)
LOC120559293 pifo other upstream 27812 8654412 ~ 8662891 (+)
LOC120559763 NA other upstream 193309 8478123 ~ 8497394 (+)
pkig pkig other upstream 310125 8342750 ~ 8380578 (+)
G47903 LOC104965021 other upstream 574475 8112441 ~ 8116228 (+)
G48162 NA other downstream 16679 8716767 ~ 8726552 (+)
LOC120559255 tshz2 other downstream 290399 8990487 ~ 9121912 (+)
G48347 NA other downstream 704136 9404224 ~ 9429947 (+)
ubxn10 NA other downstream 1222512 9922600 ~ 9925081 (+)
agmat agmat,LOC102790280 other downstream 1439510 10139598 ~ 10151251 (+)

Expression


Co-expression Network