G51174 (bgn)


Basic Information

Item Value
gene id G51174
gene name bgn
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053116.1
NCBI id CM020913.1
chromosome length 44101041
location 19617115 ~ 19618210 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU68381
CCTTTGGGGACGCGAGTGAGGCGGTTGTTGTCCAGATGCAGCTCTCTCAGCCTGGGGAGGAAGGACAGACTGCCGTTCTCGATGTTACGGATATGGTTAAAGCTAAGGCCCAACCTGTACAGGTTTTTGTAGCGTTTCAGGTCTTCCAGTTCCACAGCCTGGATCTGGTTGTGGTCCAGATGAAGCTCATGGAGACTATCTGGTAGTTCTTTTGGCACCCCAGTCAGTTTGGACTCTGATATACG

Function

symbol description
bgn Predicted to be an extracellular matrix structural constituent conferring compression resistance. Predicted to be involved in blood vessel remodeling. Predicted to act upstream of or within articular cartilage development; bone development; and peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan. Located in cell surface and transport vesicle. Colocalizes with collagen-containing extracellular matrix. Implicated in Meester-Loeys syndrome and X-linked spondyloepimetaphyseal dysplasia.

NR:

description
PREDICTED: biglycan

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU68381 True 245 lncRNA 0.52 3 19617115 19618210

Neighbor

gene id symbol gene type direction distance location
wnt5a wnt5a,LOC103367232,LOC102799772 coding upstream 201925 19366783 ~ 19415190 (+)
LOC120559318 NA coding upstream 289561 19241532 ~ 19327554 (+)
tlr9 NA coding upstream 376506 19235549 ~ 19240609 (+)
apeh NA coding upstream 381729 19225260 ~ 19235386 (+)
LOC120559315 LOC103367228,LOC104955723 coding upstream 396180 19205219 ~ 19220935 (+)
LOC120558919 LOC104941542 coding downstream 173970 19792180 ~ 19793225 (+)
LOC120558889 LOC104931868,LOC102202682,LOC102797917,LOC108235291 coding downstream 301184 19919394 ~ 19925436 (+)
kcna2b LOC104931876,LOC104941545,LOC103149635,LOC106925543,LOC107087053 coding downstream 323814 19942024 ~ 19951021 (+)
LOC120558887 LOC103360394,LOC100692715,LOC101485468,LOC102788976 coding downstream 354993 19973203 ~ 19976195 (+)
ube2t ube2t coding downstream 382939 20001149 ~ 20004112 (+)
G51165 LOC103362816 non-coding upstream 8159 19571193 ~ 19608956 (+)
G51168 LOC102792445,LOC100695140,LOC103362820,LOC104933206,LOC101467308 non-coding upstream 23491 19591468 ~ 19593624 (+)
G51167 LOC101075728,LOC104965662 non-coding upstream 26139 19588235 ~ 19590976 (+)
G51155 NA non-coding upstream 175789 19439687 ~ 19441326 (+)
G51028 NA non-coding upstream 760589 18855367 ~ 18856526 (+)
G51178 bgn non-coding downstream 2231 19620441 ~ 19624994 (+)
G51186 NA non-coding downstream 33024 19651234 ~ 19658721 (+)
G51194 LOC104956217,LOC103362813 non-coding downstream 51411 19669621 ~ 19671527 (+)
G51183 NA non-coding downstream 61288 19679498 ~ 19681767 (+)
G51184 LOC100696538,LOC103362809,LOC108265463,LOC108411640,LOC105006799 non-coding downstream 63648 19681858 ~ 19686834 (+)
LOC120558947 lrtm1,LOC102799284 other upstream 153403 19456477 ~ 19463712 (+)
G50983 LOC103366028 other upstream 930813 18682143 ~ 18686302 (+)
opn7b LOC103364157,LOC103467481 other upstream 1316782 18255892 ~ 18300333 (+)
LOC120559485 lime1,LOC103354460,LOC103467936,LOC105926125,LOC107096010,LOC103141841 other upstream 1830717 17741371 ~ 17786398 (+)
G50523 slc6a6,LOC104935489,LOC101165803,LOC100694392,LOC102780524 other upstream 2419942 17185911 ~ 17197173 (+)
LOC120558920 LOC104941542 other downstream 149416 19767626 ~ 19768564 (+)
zgc:194242 NA other downstream 378267 19996477 ~ 20000438 (+)
LOC120558901 LOC104941554,LOC102293999,LOC103360402 other downstream 445782 20063992 ~ 20065735 (+)
LOC120559772 LOC108235180,LOC102301975,LOC103385136,LOC104941571,LOC107390930,LOC103360973,LOC101475964 other downstream 827761 20445971 ~ 20532569 (+)
G51716 NA other downstream 1671378 21289588 ~ 21290962 (+)

Expression


Co-expression Network