G51922 (huwe1)


Basic Information

Item Value
gene id G51922
gene name huwe1
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053116.1
NCBI id CM020913.1
chromosome length 44101041
location 21900444 ~ 21901003 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU69343
TCTGTGCTGAATGTCAGCTCATAGCCTAGCGTGGACACATCATTCTCCAACAAGTACACCAAGCCCTGGAAGAATGGGTAGTCCTCACTCTCCATGTCTGTACCTGACACTCTTGCCCAGGATGTGCTTGTAGAAGCTGCGGGTGAAGTAGCACTCCAATAACCGGTTATCATAGACTGCCTTGGCCACCACACGACCCACAAACTTGAAGTAGCTGAGGTGGTTGGGGTTGCAGTGGGATGAGGGGTTGATGGTATAGGTGACACGGTCGCCTGGGGAAGTGCGAAACAGGGCGTACATGGGGTTGAACATCTCCCGGGAGATGATCATGTACCATTCCCTCAGCAGGCCACCAGCATCCTGGCCCTCCTCCCCTTCAAACACAATGTACCTGTAATTGAAAGGAAGCAGATTATGACTCAGGTTGAG

Function

symbol description
huwe1 Predicted to enable ubiquitin protein ligase activity. Predicted to be involved in several processes, including base-excision repair; cellular protein metabolic process; and positive regulation of protein catabolic process. Predicted to act upstream of or within DNA repair. Predicted to be active in Golgi membrane and nucleus. Human ortholog(s) of this gene implicated in syndromic X-linked intellectual disability Turner type. Orthologous to human HUWE1 (HECT, UBA and WWE domain containing E3 ubiquitin protein ligase 1).

NR:

description
PREDICTED: E3 ubiquitin-protein ligase HUWE1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU69343 True 429 lncRNA 0.52 2 21900444 21901003

Neighbor

gene id symbol gene type direction distance location
ribc1 NA coding upstream 72554 21823518 ~ 21827890 (+)
tmem9 tmem9,LOC107707676,LOC106572715,LOC107669678 coding upstream 119494 21776471 ~ 21780950 (+)
zgc:153867 LOC107390870,LOC103467339,LOC102296328,LOC104956861,LOC105928965,LOC106950810,LOC106525009,LOC101167617,LOC102221965,LOC100708807,LOC101480989 coding upstream 153727 21737480 ~ 21746717 (+)
c1galt1a LOC104956867 coding upstream 280243 21607339 ~ 21620201 (+)
LOC120559688 NA coding upstream 345249 21553252 ~ 21555195 (+)
idh3g idh3g coding downstream 121831 22022834 ~ 22028294 (+)
zgc:158263 LOC104932850,LOC104967525,LOC101474144,LOC102796628 coding downstream 209984 22110987 ~ 22119609 (+)
cacnb3b LOC103363728,LOC104967530,LOC100705687,LOC101472360 coding downstream 283293 22184296 ~ 22199110 (+)
rnd1b LOC101472065,LOC103358261,LOC100705424,LOC104932892,LOC103384592 coding downstream 302088 22203091 ~ 22213864 (+)
ptges3a LOC107390842,LOC103368333,LOC104967534,LOC100704884,LOC106525288,LOC108244561,LOC101471106 coding downstream 339479 22240482 ~ 22244763 (+)
G51921 huwe1 non-coding upstream 213 21899124 ~ 21900231 (+)
LOC120559724 NA non-coding upstream 3988 21895341 ~ 21896456 (+)
G51902 smc1a non-coding upstream 79769 21819865 ~ 21820675 (+)
G51900 smc1a non-coding upstream 86813 21812612 ~ 21813631 (+)
G51811 NA non-coding upstream 322189 21577388 ~ 21578255 (+)
G51927 NA non-coding downstream 4052 21905055 ~ 21906248 (+)
G51935 NA non-coding downstream 13322 21914325 ~ 21914837 (+)
G52006 NA non-coding downstream 130206 22031209 ~ 22031519 (+)
LOC120558642 NA non-coding downstream 184263 22085266 ~ 22086233 (+)
G52031 naa10 non-coding downstream 204642 22105645 ~ 22106945 (+)
LOC120559721 cacna1s,LOC103368470 other upstream 92530 21783217 ~ 21807914 (+)
birc5b LOC107086758,LOC102206178,LOC102295711,LOC100709346,LOC106950807,LOC103141143,LOC106920826 other upstream 180321 21717109 ~ 21720123 (+)
G51804 NA other upstream 341095 21558890 ~ 21559349 (+)
G51734 acvr1b,LOC100709886,LOC101485924 other upstream 536014 21361290 ~ 21364430 (+)
G51716 NA other upstream 609482 21289588 ~ 21290962 (+)
G51926 NA other downstream 2539 21903542 ~ 21904077 (+)
avpr2aa avpr2,LOC105897269 other downstream 145760 22046763 ~ 22060645 (+)
LOC120558641 LOC103363734,LOC104967523 other downstream 189194 22090197 ~ 22094890 (+)
G52210 LOC104964406,LOC106525460,LOC105931770 other downstream 655326 22556329 ~ 22560328 (+)
LOC120559933 NA other downstream 661151 22562154 ~ 22562521 (+)

Expression


Co-expression Network