G70255 (rnf220)


Basic Information

Item Value
gene id G70255
gene name rnf220
gene type unknown
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047598.1
NCBI id CM018544.1
chromosome length 33267568
location 24304374 ~ 24304926 (-)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU83344
GCTCAATGCGGTCTTCTGGGCTGGATGAGGCCTCGCGGTCGGACAGCAGGCCAGAGACAGCGAAGATTTTCTTTCCGGCATCCTCCACAGCCTTGAGGGCACCAGGTGAGCCTGAGGGCACGTGGGCACCACCGTAGTCATACTCTTTACCCTCGGCGTCTGAGTAGCGCAGGTGTGGAGAGGCTTCTGCCTCCAGGCAGCCCTTGAGGCGCTTTGCTGGAGTGAAAGCTGATTGGTAGGCACCTGAGGCCGAATCACGCTCTTCTGGTGGTGATGCGAAGGGCCGGAAGGCTCCGACAGCACCATGGTTGAGCACACCAATGGACGGTGGACAGTCCAGGCCAGGTGGCGCAAACTGGTGGTGCAGGTGCAGGAGAGATGGTGCAAAGTCACGGCCACCAAAGCCAGGTTGCCGGTGGTAGACGGAGGCAAAGGCGTAGGAGCCATTGGCGAATGGCAGGTGCACGTCCTTGTCGGAGACAGAGACGGGTGCACCAAACGGCCGTGGCTGCTGGCACGGGGCCGAGGCATCGCGGCTGGCATCGGCTGTCGA

Function

symbol description
rnf220 Predicted to enable ubiquitin protein ligase activity. Involved in positive regulation of canonical Wnt signaling pathway. Part of protein-containing complex.

NR:

description
PREDICTED: E3 ubiquitin-protein ligase RNF220 isoform X7

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU83344 True 553 TUCP 0.62 1 24304374 24304926

Neighbor

gene id symbol gene type direction distance location
prpf4ba prpf4b,LOC108267396 coding downstream 142581 24148572 ~ 24161793 (-)
LOC113540393 LOC103037289,LOC107098295,LOC103135689,LOC106524523,LOC108267401,LOC108232979,LOC102237517 coding downstream 159348 24139799 ~ 24145026 (-)
bfsp2 bfsp2 coding downstream 188951 24110472 ~ 24115423 (-)
nrbp2a nrbp2a,nrbp2,LOC108267406,LOC108413492,LOC107733885,LOC107599881,LOC107657444 coding downstream 220092 24045734 ~ 24084282 (-)
puf60a puf60a,LOC108267407,LOC108413493,LOC107657443,LOC107718021,LOC107599879 coding downstream 262991 24028301 ~ 24041383 (-)
b4galt2 b4galt2,LOC107657457,LOC107599894,LOC107700994,LOC107557142 coding upstream 296944 24601870 ~ 24740260 (-)
atp6v0b atp6v0b,LOC102788333 coding upstream 443175 24748101 ~ 24755113 (-)
ptch2 ptch2,LOC107557169,LOC107700991,LOC107720855,LOC107599897,LOC107722076,LOC107657459 coding upstream 578820 24883746 ~ 24911790 (-)
eif2b3 eif2b3,LOC107722074,LOC107700990,LOC107599900,LOC107720854 coding upstream 614601 24919527 ~ 24963880 (-)
cenpl cenpl coding upstream 708280 25013206 ~ 25022416 (-)
G70044 NA non-coding downstream 124510 24179031 ~ 24179864 (-)
G70027 NA non-coding downstream 158133 24145890 ~ 24146241 (-)
G70026 NA non-coding downstream 158590 24145578 ~ 24145784 (-)
G70025 NA non-coding downstream 165882 24138293 ~ 24138492 (-)
LOC117597086 NA non-coding downstream 372139 23931333 ~ 23932235 (-)
G70540 NA non-coding upstream 567704 24872630 ~ 24872833 (-)
G70906 astn1 non-coding upstream 1104788 25409714 ~ 25445048 (-)
G70970 NA non-coding upstream 1248151 25553077 ~ 25554229 (-)
G71013 NA non-coding upstream 1266383 25571309 ~ 25571525 (-)
G71037 NA non-coding upstream 1305311 25610237 ~ 25610440 (-)
LOC117597117 NA other downstream 772358 23531238 ~ 23532016 (-)
LOC113540013 NA other downstream 786704 23516930 ~ 23517670 (-)
LOC113540114 LOC108267227 other downstream 788015 23515699 ~ 23516359 (-)
LOC117597116 NA other downstream 789439 23514374 ~ 23514935 (-)
LOC113540012 NA other downstream 790335 23513456 ~ 23514039 (-)
ccdc24 ccdc24 other upstream 260815 24565741 ~ 24586048 (-)
ltb4r2b NA other upstream 2066995 26371921 ~ 26376408 (-)
G71596 NA other upstream 2167154 26472080 ~ 26551030 (-)
G71832 NA other upstream 2791676 27096602 ~ 27100858 (-)
G71909 LOC108267490 other upstream 2898857 27203783 ~ 27204186 (-)

Expression


Co-expression Network