G252311 (vps13d,LOC107712684,LOC107687459,LOC107737673)


Basic Information

Item Value
gene id G252311
gene name vps13d,LOC107712684,LOC107687459,LOC107737673
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047610.1
NCBI id CM018556.1
chromosome length 25111544
location 9895284 ~ 9895525 (-)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>TU298642
TCTATGTTCTGTGAGGTGTCTGCAGCATGGAGCACTGCCTCTTTGCCTGGCTTCATGGTTCCCTTGATTGAGGTCCCCTTGATGTAGTAGATGAGGTCACAGGGCAGCAGGTTAGTCAGCACTAAGGTGGGTAACAGGTAGATGGTGTGACCTGGCTGTCTGTAAATCTGCTTAGCACTACCAGGATAGTTCTCCTTCTTGATAACCACGCAAAA

Function

symbol description
vps13d Predicted to be involved in mitochondrion organization; protein retention in Golgi apparatus; and protein targeting to vacuole. Predicted to be extrinsic component of membrane. Human ortholog(s) of this gene implicated in autosomal recessive spinocerebellar ataxia 4. Orthologous to human VPS13D (vacuolar protein sorting 13 homolog D).

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU298642 True 215 lncRNA 0.49 2 9895284 9895525

Neighbor

gene id symbol gene type direction distance location
lactbl1a LOC108275962 coding downstream 114289 9774483 ~ 9780995 (-)
eif4g3b eif4g3,LOC108434436 coding downstream 129430 9729374 ~ 9765854 (-)
slc2a1a LOC108276488,LOC108434426,LOC106565867,LOC107703064,LOC107591105 coding downstream 231330 9652431 ~ 9663954 (-)
rap1gap LOC108276112,LOC108434374,LOC107716101 coding downstream 291927 9517287 ~ 9603357 (-)
gpr157 gpr157,LOC108434350 coding downstream 458120 9431703 ~ 9437164 (-)
dhrs3a dhrs3,dhrs3a,LOC108275517,LOC107703071,LOC107712670,LOC107737702,LOC107593436,LOC107687474 coding upstream 26653 9922178 ~ 9928130 (-)
igsf21b igsf21,LOC108275566,LOC107712688,LOC107593375,LOC107687403,LOC107737570 coding upstream 33743 9929268 ~ 9942531 (-)
arhgef10lb LOC108275881,LOC108434548,LOC107591110,LOC107712685,LOC107703072 coding upstream 49326 9944851 ~ 9982274 (-)
LOC113530673 rpl22,LOC102779685 coding upstream 103352 9998877 ~ 10002568 (-)
icmt icmt,LOC107703075,LOC107591113,LOC107593379 coding upstream 121966 10017491 ~ 10022500 (-)
G252265 NA non-coding downstream 45588 9847116 ~ 9849696 (-)
LOC117599281 NA non-coding downstream 186481 9704915 ~ 9708803 (-)
G251963 NA non-coding downstream 396983 9498090 ~ 9498301 (-)
G251955 NA non-coding downstream 405421 9488270 ~ 9489863 (-)
LOC117599283 NA non-coding downstream 443116 9449297 ~ 9452168 (-)
G252331 NA non-coding upstream 21904 9917429 ~ 9920148 (-)
G252479 NA non-coding upstream 159352 10054877 ~ 10056083 (-)
LOC117599207 NA non-coding upstream 284263 10179788 ~ 10181888 (-)
LOC117599279 NA non-coding upstream 348516 10244041 ~ 10288684 (-)
G252610 NA non-coding upstream 500870 10396395 ~ 10396740 (-)
LOC117599234 LOC108275963 other downstream 123721 9768247 ~ 9771563 (-)
ttll10 ttll10 other downstream 1316684 8566656 ~ 8578600 (-)
ctnnbip1 ctnnbip1 other downstream 2385493 7476205 ~ 7509791 (-)
nmnat1 nmnat1 other downstream 2487027 7399793 ~ 7408257 (-)
c16h1orf127 c15h1orf127,tardbp,LOC107570713 other downstream 2571338 7249631 ~ 7323946 (-)
G252373 NA other upstream 133967 10029492 ~ 10029993 (-)
usp21 LOC108276040,LOC108432659 other upstream 565169 10460694 ~ 10469796 (-)
sinup NA other upstream 740976 10636501 ~ 10638718 (-)
LOC113530950 smim4,zgc:193598,LOC108436318,LOC108276132,LOC107570281 other upstream 1113938 11009463 ~ 11015666 (-)
abhd6b LOC108275644,LOC108436291 other upstream 1125006 11020531 ~ 11025009 (-)

Expression


Co-expression Network