AMCG00000417 (lin52,LOC107594798)


Basic Information

Item Value
gene id AMCG00000417
gene name lin52,LOC107594798
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030141.1
NCBI id CM030141.1
chromosome length 22147039
location 14286016 ~ 14288319 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00000417
ATGGCGTCTCCCAGTGGAGGTGATGACTTCGAAAACTCTCTTATGAGTTTAGAGAAATTAGACCGAGCCTCTCCAGATCTGTGGCCGGAGCAACTCCCTGGGGTTGCAGAATTCGCAGCCTCCTTTAAAAGTCCGATCACAAATTCCCCACCAAAGTGGATGGCCGAACTCGAAAACGATGACATTGAGATGTTAAAAGAGTTGGGAAGTTTGACCACAGCCAACCTGATGGAGAAAGTGAAGGGACTGCAAAACCTGGCCTACCAGCTTGGGCTAGAAGAA

Function

symbol description
lin52 Predicted to act upstream of or within transcription, DNA-templated. Predicted to be part of DRM complex. Orthologous to human LIN52 (lin-52 DREAM MuvB core complex component).

NR:

description
PREDICTED: protein lin-52 homolog

GO:

id name namespace
GO:0006351 transcription, DNA-templated biological_process
GO:0007049 cell cycle biological_process
GO:0070176 DRM complex cellular_component

KEGG:

id description
K21775 LIN52; protein lin-52

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00000417 True 282 mRNA 0.49 5 14286016 14288319

Neighbor

gene id symbol gene type direction distance location
AMCG00000421 aldh6a1,LOC102788717,LOC107586880,LOC107664467,LOC107739234 coding upstream 3344 14261409 ~ 14282672 (+)
AMCG00000423 NA coding upstream 40440 14235240 ~ 14245576 (+)
AMCG00000424 NA coding upstream 57207 14224164 ~ 14228809 (+)
AMCG00000422 tmem63c,LOC107732232,LOC106611026 coding upstream 81229 14180836 ~ 14204787 (+)
AMCG00000411 NA coding upstream 126926 14157036 ~ 14159090 (+)
AMCG00000416 LOC106608304 coding downstream 27842 14316161 ~ 14340047 (+)
AMCG00000420 NA coding downstream 53181 14341500 ~ 14342163 (+)
AMCG00000419 NA coding downstream 67572 14355891 ~ 14357921 (+)
AMCG00000433 NA coding downstream 253938 14542257 ~ 14545457 (+)
AMCG00000431 LOC107732571 coding downstream 260343 14548662 ~ 14567052 (+)
G150106 NA non-coding upstream 539900 13739776 ~ 13746116 (+)
G150066 LOC100846954,LOC107575789 non-coding upstream 635965 13649403 ~ 13650051 (+)
G150042 NA non-coding upstream 872952 13412865 ~ 13413064 (+)
G149869 LOC105909576,LOC107704376 non-coding upstream 1444343 12833539 ~ 12841673 (+)
G149747 NA non-coding upstream 2187644 12092387 ~ 12098372 (+)
G150303 NA non-coding downstream 176573 14464892 ~ 14465302 (+)
G150364 NA non-coding downstream 444913 14733232 ~ 14733440 (+)
G150455 NA non-coding downstream 836391 15124710 ~ 15125951 (+)
G150457 NA non-coding downstream 849387 15137706 ~ 15137923 (+)
G150458 NA non-coding downstream 866316 15154635 ~ 15155084 (+)
AMCG00000412 pgf,LOC102799665,LOC102204058,LOC106593515,LOC106611025 other upstream 132176 14133138 ~ 14153840 (+)
G150069 NA other upstream 593427 13690839 ~ 13692589 (+)
AMCG00000381 NA other upstream 1255163 12966877 ~ 13030853 (+)
G149859 NA other upstream 1558113 12679670 ~ 12727903 (+)
AMCG00000352 NA other upstream 2290990 11965555 ~ 11995026 (+)
AMCG00000443 esrrb,LOC106611051,LOC101473368,LOC100708924 other downstream 643459 14931778 ~ 14944400 (+)
AMCG00000514 NA other downstream 2523134 16811453 ~ 16814365 (+)
G150750 NA other downstream 2647674 16935993 ~ 16938282 (+)
G150811 NA other downstream 3257135 17545454 ~ 17548508 (+)
AMCG00000525 NA other downstream 3460191 17748510 ~ 17759582 (+)

Expression


Co-expression Network