AMCG00000461 (clg15h14orf1,LOC106591002,LOC107724257,LOC104921354,LOC107554785,LOC102222511)


Basic Information

Item Value
gene id AMCG00000461
gene name clg15h14orf1,LOC106591002,LOC107724257,LOC104921354,LOC107554785,LOC102222511
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030141.1
NCBI id CM030141.1
chromosome length 22147039
location 15185447 ~ 15187339 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00000461
ATGAGTCGCTTCCTGAACGTGCTTCGTAGTTGGCTCGTAATGGTGTCAGTCATTGCGATGGGGAACACGGTGCAGAGTTTTCGGGATCACAGTTTCCTCTCTGAGAAACTGTACACTGGAACACCGGAGTTTGTAAACGGCCTTCAAGCTCGAACCTTTGGAATCTGGACCTTGCTGTCCTCCATCATTCGCTGTGCCTGTGCCATAGACATCCAGAACAAAGCGCTCTATCATATCACACTGTGGACGTTTGTTCTAGCACTGGGACACTTCTTGTCTGAGGTGTTCATTTATAAAACTGCCCCTCTGACTATTGGAGTTATGGCACCACTCATAGTGGCAAGTTTCTCCATCGTGGGGATGCTGATTGGCTTGCAGTGCGTGGCAGAACCCCAGGAAGTGGTGGGGGCGAGGCAGAAGAAACGCAATTGA

Function

NR:

description
PREDICTED: probable ergosterol biosynthetic protein 28 isoform X2

GO:

id name namespace
GO:0016021 integral component of membrane cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00000461 True 432 mRNA 0.50 4 15185447 15187339

Neighbor

gene id symbol gene type direction distance location
AMCG00000456 tgfb3,LOC106590795 coding upstream 61846 15110845 ~ 15123601 (+)
AMCG00000448 NA coding upstream 306330 14872432 ~ 14879117 (+)
AMCG00000447 dlst,LOC107092408,LOC105916992 coding upstream 376171 14799725 ~ 14809276 (+)
AMCG00000449 NA coding upstream 405483 14757134 ~ 14779964 (+)
AMCG00000437 fcf1,LOC106589732 coding upstream 429522 14752253 ~ 14755925 (+)
AMCG00000468 NA coding downstream 73752 15261091 ~ 15262791 (+)
AMCG00000460 tmed10,LOC106608292 coding downstream 84116 15271455 ~ 15276495 (+)
AMCG00000462 eif2b2 coding downstream 91117 15278456 ~ 15281462 (+)
AMCG00000473 NA coding downstream 104976 15292315 ~ 15294469 (+)
AMCG00000474 eml5 coding downstream 165638 15352977 ~ 15384001 (+)
G150460 NA non-coding upstream 24770 15160457 ~ 15160677 (+)
G150459 NA non-coding upstream 25324 15159608 ~ 15160123 (+)
G150458 NA non-coding upstream 30363 15154635 ~ 15155084 (+)
G150457 NA non-coding upstream 47524 15137706 ~ 15137923 (+)
G150455 NA non-coding upstream 59496 15124710 ~ 15125951 (+)
G150475 NA non-coding downstream 41618 15228957 ~ 15229262 (+)
G150484 NA non-coding downstream 63178 15250517 ~ 15250729 (+)
G150506 NA non-coding downstream 108268 15295607 ~ 15299878 (+)
G150563 NA non-coding downstream 427791 15615130 ~ 15619026 (+)
G150642 NA non-coding downstream 1003481 16190820 ~ 16191021 (+)
AMCG00000443 esrrb,LOC106611051,LOC101473368,LOC100708924 other upstream 241047 14931778 ~ 14944400 (+)
AMCG00000412 pgf,LOC102799665,LOC102204058,LOC106593515,LOC106611025 other upstream 1031607 14133138 ~ 14153840 (+)
G150069 NA other upstream 1492858 13690839 ~ 13692589 (+)
AMCG00000381 NA other upstream 2154594 12966877 ~ 13030853 (+)
G149859 NA other upstream 2457544 12679670 ~ 12727903 (+)
AMCG00000514 NA other downstream 1624114 16811453 ~ 16814365 (+)
G150750 NA other downstream 1748654 16935993 ~ 16938282 (+)
G150811 NA other downstream 2358115 17545454 ~ 17548508 (+)
AMCG00000525 NA other downstream 2561171 17748510 ~ 17759582 (+)
G150976 NA other downstream 2966525 18153864 ~ 18159321 (+)

Expression


Co-expression Network