AMCG00000695 (cps1)


Basic Information

Item Value
gene id AMCG00000695
gene name cps1
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030137.1
NCBI id CM030137.1
chromosome length 27060302
location 414444 ~ 414795 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00000695
ATGTCCCTCAGGCTCATTACAGACGGGGACATCGACCTGGTGGTGAACCTGCCCAACAACAACACCATGTTCATCAAGGACAACTTCCTGATCCGCAGGATGGCCATCGACCACGGGGTGCCCCTCATCACCAACTTCCAGGTTGTGAACCTGTTTGCCGAGGCCATCAAGCACTCCGGCAAACTGGACGCCACCAGCCTCTTCCACTACCGCCAGCAGGACACCAGCCAGCAAGGCTAG

Function

symbol description
cps1 Enables carbamoyl-phosphate synthase (ammonia) activity. Acts upstream of or within ammonium homeostasis and urea cycle. Predicted to be active in cytoplasm. Is expressed in ball; brain; liver; and muscle. Human ortholog(s) of this gene implicated in carbamoyl phosphate synthetase I deficiency disease; persistent fetal circulation syndrome; and vascular disease. Orthologous to human CPS1 (carbamoyl-phosphate synthase 1).

NR:

description
PREDICTED: carbamoyl-phosphate synthase [ammonia], mitochondrial

GO:

id name namespace
GO:0070409 carbamoyl phosphate biosynthetic process biological_process
GO:0006543 glutamine catabolic process biological_process
GO:0005524 ATP binding molecular_function
GO:0046872 metal ion binding molecular_function
GO:0003824 catalytic activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00000695 True 240 mRNA 0.58 2 414444 414795

Neighbor

gene id symbol gene type direction distance location
AMCG00000694 NA coding upstream 16 367576 ~ 414428 (+)
AMCG00000683 unc80 coding upstream 270549 138105 ~ 143895 (+)
AMCG00000681 NA coding upstream 373848 38752 ~ 40596 (+)
AMCG00000680 NA coding upstream 388163 21907 ~ 26281 (+)
AMCG00000702 vwc2l coding downstream 697086 1111881 ~ 1133185 (+)
AMCG00000705 NA coding downstream 811522 1226317 ~ 1233934 (+)
AMCG00000708 NA coding downstream 833946 1248741 ~ 1249425 (+)
AMCG00000704 NA coding downstream 841986 1256781 ~ 1272965 (+)
AMCG00000715 NA coding downstream 980601 1395396 ~ 1395970 (+)
G125565 NA non-coding upstream 58715 354488 ~ 355729 (+)
G125516 NA non-coding upstream 285317 128859 ~ 129127 (+)
G125510 pofut2 non-coding upstream 297142 116111 ~ 117302 (+)
G125485 NA non-coding upstream 321824 92283 ~ 92620 (+)
G125484 NA non-coding upstream 323159 91043 ~ 91285 (+)
G125597 NA non-coding downstream 41707 456502 ~ 487203 (+)
G125605 erbb4,LOC107555909,LOC107741926,LOC107662043,LOC107721020,LOC107660610 non-coding downstream 115104 529899 ~ 531912 (+)
G125612 NA non-coding downstream 160495 575290 ~ 575492 (+)
G125613 NA non-coding downstream 181992 596787 ~ 597135 (+)
G125684 myo1b non-coding downstream 889300 1304095 ~ 1307335 (+)
G125561 NA other upstream 10853 339640 ~ 403591 (+)
AMCG00000723 crygs,LOC107756035,LOC107663530,LOC105911960,LOC103033891 other downstream 1184901 1599696 ~ 1606031 (+)
AMCG00000729 satb2,LOC107690605,LOC107569722 other downstream 1254050 1668845 ~ 1698573 (+)
AMCG00000734 NA other downstream 1390612 1805407 ~ 1814157 (+)
AMCG00000848 NA other downstream 5046506 5461301 ~ 5465981 (+)
G127134 NA other downstream 8202404 8617199 ~ 8620195 (+)

Expression


Co-expression Network