AMCG00000696 (erbb4,LOC107741926,LOC107555909,LOC107660610,LOC107662043,LOC107721020)


Basic Information

Item Value
gene id AMCG00000696
gene name erbb4,LOC107741926,LOC107555909,LOC107660610,LOC107662043,LOC107721020
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030137.1
NCBI id CM030137.1
chromosome length 27060302
location 531041 ~ 536858 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00000696
ATGAACACAACAGTCCTCCTGGACAAGCTGCCCCCCCACCCGCGCGCCGCCCCGCCCCCCTGTGCCTCCGCCCCGCCCCCCGAGCCCCCGGCCGCCCAGGGGGGTCCGCTGGAGGCCTGCGAGGACCCGCGCTGTAACGGCACCCTGAGGAAGCAGGCGTCGCCGCGGCCAGGTGAGGACAGCAGCGCCCAGCGCTACAGCGCCGACCCCACCGGCTTCCTGGCGGAGCGCGGGCCGCGGGCGGATGTGGACGGGGACGGCTACATGACCCCCATGACGGACAAGGCGCCCACAGGTGAGCCCCCTCAGGCGGCAGGGCGGAGGGTCACCTTCCTCTTGGGCCTGGCAGGCGTCTCCATCTCCTTCTGTCTCACGCTCTTGTCTCCTGGCGCAGACTATCTCAACCCCGTGGAGGAGAACCCCTTCGTGACGCGGCGCAAGAATGGGGACGTGCACGCGCTGGACAACCCCGGCTACCACGGCCATGCCGCGCCCAACGGACAGCCCCGGCTGGAGGACGAGTACGTGAACGAGCCGCTGTACCTCAACACCTTCCACAACGCCGGGGCCGACAAGAACCCCGAGTTCCTGAAGAAGAACGGGCTGCCGCCGCCTCCGCCGCACCCCCACCCACCGCACCCCGCCCTCGCCATCGCCCACACGGCCGCCACCACCGGCACGCTGGCCGACAAGAAGCCCAAGAAGACGTTCGACAATCCGGAGTACTGGCACCACAGCCTGCCACCCAAGTCCACGCTGCACAACCCCGAGTACCTGCCGGAGTGCAACACCAAGTTCTTCTACAAACAGAACGGGCGCATCCGGCCGGTGGTGGCGGAGAACCCCGAGTACCTGTCCGAGTTCTCCCTGAAGCCCGGCAACGTGCTGCCGCCCCCCCCCTACCGCCAGAGGAACACTGTGGTGTAG

Function

symbol description
erbb4 Enables several functions, including epidermal growth factor receptor binding activity; protein homodimerization activity; and transmembrane receptor protein tyrosine kinase activity. Involved in several processes, including positive regulation of phosphorylation; positive regulation of signal transduction; and protein phosphorylation. Located in basolateral plasma membrane; mitochondrion; and nucleus. Part of receptor complex. Implicated in amyotrophic lateral sclerosis type 19; colorectal cancer; esophagus squamous cell carcinoma; hepatocellular carcinoma; and lung adenocarcinoma. Biomarker of carcinoma (multiple); ductal carcinoma in situ; reproductive organ cancer (multiple); and urinary bladder cancer.

NR:

description
PREDICTED: receptor tyrosine-protein kinase erbB-4 isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00000696 True 927 mRNA 0.69 3 531041 536858

Neighbor

gene id symbol gene type direction distance location
AMCG00000691 NA coding downstream 164925 354488 ~ 366116 (-)
AMCG00000693 NA coding downstream 182631 339733 ~ 348410 (-)
AMCG00000692 acadl coding downstream 192780 332223 ~ 338261 (-)
AMCG00000690 NA coding downstream 201992 307481 ~ 329049 (-)
AMCG00000688 unc80 coding downstream 338713 145779 ~ 192328 (-)
AMCG00000697 NA coding upstream 5198 542056 ~ 544156 (-)
AMCG00000700 LOC108441681,LOC108440448 coding upstream 53987 590845 ~ 612323 (-)
AMCG00000698 erbb4 coding upstream 106755 643613 ~ 647413 (-)
AMCG00000699 NA coding upstream 142156 679014 ~ 680483 (-)
AMCG00000701 NA coding upstream 305413 842271 ~ 859811 (-)
G125622 NA non-coding downstream 3540 523521 ~ 527501 (-)
G125591 NA non-coding downstream 120224 409615 ~ 410817 (-)
G125578 NA non-coding downstream 154271 375820 ~ 376770 (-)
G125515 NA non-coding downstream 403378 121280 ~ 127663 (-)
G125498 NA non-coding downstream 438386 92283 ~ 92655 (-)
G125625 NA non-coding upstream 61126 597984 ~ 598335 (-)
G125642 NA non-coding upstream 350296 887154 ~ 887476 (-)
G125685 NA non-coding upstream 732373 1269231 ~ 1307353 (-)
G125712 NA non-coding upstream 782676 1319534 ~ 1319813 (-)
G125719 NA non-coding upstream 786645 1323503 ~ 1328648 (-)
AMCG00000687 map2 other downstream 286864 194644 ~ 244177 (-)
AMCG00000710 myo1b other upstream 770963 1307821 ~ 1312408 (-)
G125814 NA other upstream 849985 1386843 ~ 1422410 (-)
AMCG00000719 NA other upstream 941882 1478740 ~ 1500661 (-)
AMCG00000731 NA other upstream 1225171 1762029 ~ 1771025 (-)
AMCG00000741 gtf3c3,LOC104966512 other upstream 1292686 1829544 ~ 1831310 (-)

Expression


Co-expression Network